Incidental Mutation 'R3196:Pla2r1'
ID267622
Institutional Source Beutler Lab
Gene Symbol Pla2r1
Ensembl Gene ENSMUSG00000054580
Gene Namephospholipase A2 receptor 1
SynonymsM-type receptor, Pla2g1br, PLA2-I receptor
MMRRC Submission 040617-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3196 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location60417543-60553308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60522783 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 278 (E278G)
Ref Sequence ENSEMBL: ENSMUSP00000108144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112525]
Predicted Effect probably damaging
Transcript: ENSMUST00000067708
AA Change: E278G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065205
Gene: ENSMUSG00000054580
AA Change: E278G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
RICIN 42 154 2.98e-16 SMART
FN2 174 222 1.17e-25 SMART
CLECT 232 357 7.66e-30 SMART
CLECT 380 504 1.88e-29 SMART
CLECT 517 644 5.42e-21 SMART
CLECT 664 797 3.58e-21 SMART
CLECT 812 938 7.55e-20 SMART
CLECT 957 1096 5.05e-30 SMART
CLECT 1113 1232 4.72e-21 SMART
CLECT 1246 1377 1.44e-25 SMART
transmembrane domain 1397 1419 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112525
AA Change: E278G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108144
Gene: ENSMUSG00000054580
AA Change: E278G

DomainStartEndE-ValueType
low complexity region 35 62 N/A INTRINSIC
RICIN 77 189 2.98e-16 SMART
FN2 209 257 1.17e-25 SMART
CLECT 267 392 7.66e-30 SMART
CLECT 415 539 1.88e-29 SMART
CLECT 552 679 5.42e-21 SMART
CLECT 699 832 3.58e-21 SMART
CLECT 847 973 7.55e-20 SMART
CLECT 992 1131 5.05e-30 SMART
CLECT 1148 1267 4.72e-21 SMART
CLECT 1281 1412 1.44e-25 SMART
transmembrane domain 1432 1454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128208
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a phospholipase A2 receptor. The encoded protein likely exists as both a transmembrane form and a soluble form. The transmembrane receptor may play a role in clearance of phospholipase A2, thereby inhibiting its action. Polymorphisms at this locus have been associated with susceptibility to idiopathic membranous nephropathy. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null mice are viable and fertile with no overt abnormalities. These mice are more resistant to toxic effects of lipopolysaccharide than controls, suggesting a role for this gene in the progression of endotoxic shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Aes A G 10: 81,565,640 N181D probably benign Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Amelx T C X: 169,181,830 probably benign Het
Brap G A 5: 121,665,196 V136I possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Csk A T 9: 57,630,273 C119* probably null Het
Dcbld1 T C 10: 52,319,491 L265P probably damaging Het
Desi1 T A 15: 82,003,775 K31N probably damaging Het
Dpy19l2 C A 9: 24,695,989 G59C probably damaging Het
Eif2b5 T C 16: 20,505,522 V498A probably benign Het
Epdr1 A T 13: 19,594,645 Y94N probably damaging Het
Fat1 T C 8: 44,951,868 V552A probably benign Het
Focad A G 4: 88,407,351 E151G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Frem2 A T 3: 53,537,331 Y2460N probably damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Gpalpp1 A C 14: 76,098,623 probably null Het
Grid2ip A G 5: 143,388,178 I858V probably damaging Het
Grin2b ATTGTTGT ATTGT 6: 135,732,455 probably benign Het
Hps4 A G 5: 112,364,563 T182A probably damaging Het
Impa1 A T 3: 10,329,015 probably null Het
Kcnh3 T C 15: 99,233,981 S606P probably damaging Het
Kif23 T A 9: 61,931,911 R301* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lcp2 G T 11: 34,090,670 A529S probably benign Het
Lhx8 G A 3: 154,330,288 A22V probably benign Het
Lin28a A T 4: 134,007,924 S134T possibly damaging Het
Med27 T A 2: 29,346,870 V9E possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Mtcl1 T G 17: 66,343,834 E1545D probably benign Het
Muc16 A G 9: 18,497,830 Y187H probably damaging Het
Myo3a G T 2: 22,399,868 K678N possibly damaging Het
Nsmce1 T C 7: 125,486,473 M15V probably benign Het
Nxpe3 A T 16: 55,849,715 N342K probably damaging Het
Olfr229 T A 9: 39,910,460 I219N probably damaging Het
Olfr843 A G 9: 19,249,199 S67P probably damaging Het
Pcdhb9 A G 18: 37,401,610 N219S probably benign Het
Pck2 T A 14: 55,543,992 V190E probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Phf1 T C 17: 26,934,455 V54A probably damaging Het
Ptges3 G T 10: 128,072,147 R122L probably benign Het
Rnpepl1 C T 1: 92,917,159 T391I probably damaging Het
Rps6kb1 G A 11: 86,506,807 A404V probably benign Het
Rrm2b T C 15: 37,945,147 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc9b2 G T 3: 135,336,529 R523L probably benign Het
Slco1c1 T A 6: 141,531,448 probably null Het
Stox2 T C 8: 47,192,830 T532A probably damaging Het
Tbcel A G 9: 42,415,952 L385P probably damaging Het
Tmem268 G A 4: 63,577,912 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top3a G A 11: 60,759,356 T122M probably damaging Het
Trav7n-4 G A 14: 53,091,631 V33I probably benign Het
Ttn T G 2: 76,709,207 E26151D possibly damaging Het
Ttn C T 2: 76,856,884 probably benign Het
Tyk2 A G 9: 21,124,032 C195R possibly damaging Het
Ugt2b38 T C 5: 87,410,219 K528E probably damaging Het
Usp28 T A 9: 49,025,825 D483E probably benign Het
Vldlr A G 19: 27,243,154 D598G probably damaging Het
Vmn1r51 T G 6: 90,129,516 I138S probably damaging Het
Vps13b G A 15: 35,869,395 A2682T probably damaging Het
Wac T A 18: 7,917,568 V346E probably damaging Het
Zdbf2 T C 1: 63,308,420 V1986A possibly damaging Het
Other mutations in Pla2r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Pla2r1 APN 2 60420425 missense probably benign
IGL00886:Pla2r1 APN 2 60424324 missense probably damaging 1.00
IGL00928:Pla2r1 APN 2 60535080 missense probably damaging 0.99
IGL01361:Pla2r1 APN 2 60479470 missense probably damaging 1.00
IGL01403:Pla2r1 APN 2 60424288 missense probably damaging 0.99
IGL01475:Pla2r1 APN 2 60441081 splice site probably benign
IGL01517:Pla2r1 APN 2 60504253 missense probably damaging 1.00
IGL01646:Pla2r1 APN 2 60495364 missense probably damaging 1.00
IGL02208:Pla2r1 APN 2 60428588 missense possibly damaging 0.81
IGL02301:Pla2r1 APN 2 60452436 missense probably benign 0.01
IGL02522:Pla2r1 APN 2 60428669 missense probably benign 0.11
IGL02688:Pla2r1 APN 2 60455201 missense probably damaging 1.00
IGL02822:Pla2r1 APN 2 60455173 missense probably damaging 1.00
IGL02850:Pla2r1 APN 2 60502069 missense probably benign 0.03
IGL03233:Pla2r1 APN 2 60428580 missense possibly damaging 0.63
IGL03350:Pla2r1 APN 2 60455173 missense probably damaging 1.00
IGL02980:Pla2r1 UTSW 2 60515046 missense possibly damaging 0.77
R0105:Pla2r1 UTSW 2 60514981 missense possibly damaging 0.89
R0105:Pla2r1 UTSW 2 60514981 missense possibly damaging 0.89
R0387:Pla2r1 UTSW 2 60432601 missense probably benign 0.03
R0522:Pla2r1 UTSW 2 60479515 missense probably benign 0.01
R0550:Pla2r1 UTSW 2 60425350 critical splice donor site probably null
R0718:Pla2r1 UTSW 2 60479530 missense possibly damaging 0.55
R0906:Pla2r1 UTSW 2 60514947 missense possibly damaging 0.79
R0945:Pla2r1 UTSW 2 60458410 missense possibly damaging 0.89
R1229:Pla2r1 UTSW 2 60534762 missense probably benign 0.09
R1397:Pla2r1 UTSW 2 60534762 missense probably benign 0.09
R1667:Pla2r1 UTSW 2 60420257 missense probably benign 0.00
R1668:Pla2r1 UTSW 2 60428646 missense probably damaging 0.99
R1694:Pla2r1 UTSW 2 60441084 critical splice donor site probably null
R1864:Pla2r1 UTSW 2 60428711 missense probably benign 0.01
R2029:Pla2r1 UTSW 2 60431973 missense probably damaging 0.99
R2035:Pla2r1 UTSW 2 60422736 missense probably damaging 1.00
R2207:Pla2r1 UTSW 2 60458435 missense probably damaging 1.00
R2429:Pla2r1 UTSW 2 60514968 missense probably damaging 1.00
R3522:Pla2r1 UTSW 2 60448906 missense probably damaging 1.00
R3973:Pla2r1 UTSW 2 60448962 missense probably benign 0.30
R4006:Pla2r1 UTSW 2 60522873 missense probably damaging 1.00
R4091:Pla2r1 UTSW 2 60432593 missense probably damaging 1.00
R4158:Pla2r1 UTSW 2 60422622 missense probably damaging 0.97
R4160:Pla2r1 UTSW 2 60422622 missense probably damaging 0.97
R4168:Pla2r1 UTSW 2 60497614 nonsense probably null
R4541:Pla2r1 UTSW 2 60427738 missense probably damaging 1.00
R4712:Pla2r1 UTSW 2 60428650 missense probably damaging 1.00
R4797:Pla2r1 UTSW 2 60504180 missense possibly damaging 0.47
R4884:Pla2r1 UTSW 2 60534984 missense probably damaging 1.00
R4923:Pla2r1 UTSW 2 60422712 missense probably benign 0.31
R5017:Pla2r1 UTSW 2 60522760 splice site probably null
R5116:Pla2r1 UTSW 2 60448906 missense probably damaging 1.00
R5641:Pla2r1 UTSW 2 60514984 missense probably damaging 1.00
R5807:Pla2r1 UTSW 2 60428721 missense possibly damaging 0.78
R5898:Pla2r1 UTSW 2 60422760 missense probably damaging 1.00
R6241:Pla2r1 UTSW 2 60502199 splice site probably null
R6923:Pla2r1 UTSW 2 60514966 missense probably benign 0.11
R7020:Pla2r1 UTSW 2 60447399 missense possibly damaging 0.79
R7028:Pla2r1 UTSW 2 60458393 missense probably damaging 0.98
R7257:Pla2r1 UTSW 2 60427625 critical splice donor site probably null
R7291:Pla2r1 UTSW 2 60530435 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GGTCGACATGTACACATATGTTG -3'
(R):5'- TCTTAGATATCACTGTGGAGGGGAAC -3'

Sequencing Primer
(F):5'- CGCACACTCAAAATGAAGGTTTTAG -3'
(R):5'- CACTGTGGAGGGGAACACTGTC -3'
Posted On2015-02-18