Incidental Mutation 'R3196:Impa1'
ID267625
Institutional Source Beutler Lab
Gene Symbol Impa1
Ensembl Gene ENSMUSG00000027531
Gene Nameinositol (myo)-1(or 4)-monophosphatase 1
Synonymslithium-sensitive myo-inositol monophosphatase A1, 2900059K10Rik, 2610002K09Rik
MMRRC Submission 040617-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R3196 (G1)
Quality Score195
Status Not validated
Chromosome3
Chromosomal Location10311956-10331439 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 10329015 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065938] [ENSMUST00000078748] [ENSMUST00000118410] [ENSMUST00000128912] [ENSMUST00000191670] [ENSMUST00000192603]
Predicted Effect probably null
Transcript: ENSMUST00000065938
SMART Domains Protein: ENSMUSP00000068174
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 271 1.5e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078748
SMART Domains Protein: ENSMUSP00000077808
Gene: ENSMUSG00000058921

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SBF 144 328 1.1e-34 PFAM
transmembrane domain 336 358 N/A INTRINSIC
transmembrane domain 365 384 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118410
SMART Domains Protein: ENSMUSP00000113860
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 271 7.7e-79 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000128912
SMART Domains Protein: ENSMUSP00000116088
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 19 90 4.4e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000191670
SMART Domains Protein: ENSMUSP00000141345
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 180 4.7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192603
SMART Domains Protein: ENSMUSP00000141735
Gene: ENSMUSG00000103392

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that dephosphorylates myo-inositol monophosphate to generate free myo-inositol, a precursor of phosphatidylinositol, and is therefore an important modulator of intracellular signal transduction via the production of the second messengers myoinositol 1,4,5-trisphosphate and diacylglycerol. This enzyme can also use myo-inositol-1,3-diphosphate, myo-inositol-1,4-diphosphate, scyllo-inositol-phosphate, glucose-1-phosphate, glucose-6-phosphate, fructose-1-phosphate, beta-glycerophosphate, and 2'-AMP as substrates. This enzyme shows magnesium-dependent phosphatase activity and is inhibited by therapeutic concentrations of lithium. Inhibition of inositol monophosphate hydroylosis and subsequent depletion of inositol for phosphatidylinositol synthesis may explain the anti-manic and anti-depressive effects of lithium administered to treat bipolar disorder. Alternative splicing results in multiple transcript variants encoding distinct isoforms. A pseudogene of this gene is also present on chromosome 8q21.13. [provided by RefSeq, Dec 2014]
PHENOTYPE: Most mice homozygous for a knock-out allele die between E9.5 and E10.5 with surviving mice exhibiting hyperactivity, increased rearing, and increased susceptibility to pilocarpine-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,736 N158K probably benign Het
Acnat1 G C 4: 49,447,457 P357A probably damaging Het
Aes A G 10: 81,565,640 N181D probably benign Het
Akap6 T A 12: 53,072,457 C1102* probably null Het
Amelx T C X: 169,181,830 E178G probably benign Het
Brap G A 5: 121,665,196 V136I possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Csgalnact1 TGG TG 8: 68,461,085 probably null Het
Csk A T 9: 57,630,273 C119* probably null Het
Dcbld1 T C 10: 52,319,491 L265P probably damaging Het
Desi1 T A 15: 82,003,775 K31N probably damaging Het
Dpy19l2 C A 9: 24,695,989 G59C probably damaging Het
Eif2b5 T C 16: 20,505,522 V498A probably benign Het
Epdr1 A T 13: 19,594,645 Y94N probably damaging Het
Fat1 T C 8: 44,951,868 V552A probably benign Het
Focad A G 4: 88,407,351 E1745G possibly damaging Het
Frem1 A G 4: 83,014,114 F117L probably damaging Het
Frem2 A T 3: 53,537,331 Y2460N probably damaging Het
Gm3604 A T 13: 62,370,054 C163* probably null Het
Gpalpp1 A C 14: 76,098,623 probably null Het
Grid2ip A G 5: 143,388,178 I858V probably damaging Het
Grin2b ATTGTTGT ATTGT 6: 135,732,455 probably benign Het
Hps4 A G 5: 112,364,563 T182A probably damaging Het
Kcnh3 T C 15: 99,233,981 S606P probably damaging Het
Kif23 T A 9: 61,931,911 R301* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lcp2 G T 11: 34,090,670 A529S probably benign Het
Lhx8 G A 3: 154,330,288 A22V probably benign Het
Lin28a A T 4: 134,007,924 S134T possibly damaging Het
Med27 T A 2: 29,346,870 V9E possibly damaging Het
Mmp7 C A 9: 7,692,218 S31R probably benign Het
Mtcl1 T G 17: 66,343,834 E1545D probably benign Het
Muc16 A G 9: 18,497,830 Y187H probably damaging Het
Myo3a G T 2: 22,399,868 K678N possibly damaging Het
Nsmce1 T C 7: 125,486,473 M15V probably benign Het
Nxpe3 A T 16: 55,849,715 N342K probably damaging Het
Olfr229 T A 9: 39,910,460 I219N probably damaging Het
Olfr843 A G 9: 19,249,199 S67P probably damaging Het
Pcdhb9 A G 18: 37,401,610 N219S probably benign Het
Pck2 T A 14: 55,543,992 V198E probably damaging Het
Pde4b G A 4: 102,599,643 A429T probably damaging Het
Phf1 T C 17: 26,934,455 V54A probably damaging Het
Pla2r1 T C 2: 60,522,783 E278G probably damaging Het
Ptges3 G T 10: 128,072,147 R122L probably benign Het
Rnpepl1 C T 1: 92,917,159 T391I probably damaging Het
Rps6kb1 G A 11: 86,506,807 A404V probably benign Het
Rrm2b T C 15: 37,945,147 Q116R probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Skint9 T G 4: 112,390,951 I199L probably benign Het
Slc9b2 G T 3: 135,336,529 R523L probably benign Het
Slco1c1 T A 6: 141,531,448 probably null Het
Stox2 T C 8: 47,192,830 T532A probably damaging Het
Tbcel A G 9: 42,415,952 L385P probably damaging Het
Tmem268 G A 4: 63,577,912 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Top3a G A 11: 60,759,356 T147M probably damaging Het
Trav7n-4 G A 14: 53,091,631 V33I probably benign Het
Ttn T G 2: 76,709,207 E26151D possibly damaging Het
Ttn C T 2: 76,856,884 V715I probably benign Het
Tyk2 A G 9: 21,124,032 C195R possibly damaging Het
Ugt2b38 T C 5: 87,410,219 K528E probably damaging Het
Usp28 T A 9: 49,025,825 D483E probably benign Het
Vldlr A G 19: 27,243,154 D598G probably damaging Het
Vmn1r51 T G 6: 90,129,516 I138S probably damaging Het
Vps13b G A 15: 35,869,395 A2682T probably damaging Het
Wac T A 18: 7,917,568 V394E probably damaging Het
Zdbf2 T C 1: 63,308,420 V1986A possibly damaging Het
Other mutations in Impa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Impa1 APN 3 10322948 missense probably damaging 1.00
IGL02411:Impa1 APN 3 10322958 missense possibly damaging 0.90
IGL02733:Impa1 APN 3 10328965 missense probably benign
IGL03183:Impa1 APN 3 10322994 missense probably damaging 1.00
lofty UTSW 3 10329004 missense probably null 1.00
R0166:Impa1 UTSW 3 10328960 missense probably damaging 0.99
R0782:Impa1 UTSW 3 10322896 splice site probably benign
R1645:Impa1 UTSW 3 10328441 missense possibly damaging 0.79
R3905:Impa1 UTSW 3 10316034 missense probably benign
R4953:Impa1 UTSW 3 10315280 missense probably damaging 1.00
R5495:Impa1 UTSW 3 10326170 missense probably benign 0.08
R5884:Impa1 UTSW 3 10316224 missense probably damaging 1.00
R5972:Impa1 UTSW 3 10329004 missense probably null 1.00
X0054:Impa1 UTSW 3 10316100 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCACATGTAGATTACTCAAAGCATG -3'
(R):5'- CACTTGGGAGACAGCTTCATAG -3'

Sequencing Primer
(F):5'- GCATGCTTTGTTGACCAAAACTGC -3'
(R):5'- TGGGCTATGAGACACTGACTC -3'
Posted On2015-02-18