Incidental Mutation 'R3196:Kirrel1'
ID 267627
Institutional Source Beutler Lab
Gene Symbol Kirrel1
Ensembl Gene ENSMUSG00000041734
Gene Name kirre like nephrin family adhesion molecule 1
Synonyms 6720469N11Rik, Neph1, Kirrel1, Kirrel
MMRRC Submission 040617-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3196 (G1)
Quality Score 192
Status Not validated
Chromosome 3
Chromosomal Location 86985900-87082054 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 86996458 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 380 (M380I)
Ref Sequence ENSEMBL: ENSMUSP00000125525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]
AlphaFold Q80W68
Predicted Effect probably null
Transcript: ENSMUST00000041732
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107618
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159976
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Meta Mutation Damage Score 0.0922 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]
Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 57,892,132 (GRCm39) N158K probably benign Het
Acnat1 G C 4: 49,447,457 (GRCm39) P357A probably damaging Het
Akap6 T A 12: 53,119,240 (GRCm39) C1102* probably null Het
Amelx T C X: 167,964,826 (GRCm39) probably benign Het
Brap G A 5: 121,803,259 (GRCm39) V136I possibly damaging Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Csgalnact1 TGG TG 8: 68,913,737 (GRCm39) probably null Het
Csk A T 9: 57,537,556 (GRCm39) C119* probably null Het
Dcbld1 T C 10: 52,195,587 (GRCm39) L265P probably damaging Het
Desi1 T A 15: 81,887,976 (GRCm39) K31N probably damaging Het
Dpy19l2 C A 9: 24,607,285 (GRCm39) G59C probably damaging Het
Eif2b5 T C 16: 20,324,272 (GRCm39) V498A probably benign Het
Epdr1 A T 13: 19,778,815 (GRCm39) Y94N probably damaging Het
Fat1 T C 8: 45,404,905 (GRCm39) V552A probably benign Het
Focad A G 4: 88,325,588 (GRCm39) E151G possibly damaging Het
Frem1 A G 4: 82,932,351 (GRCm39) F117L probably damaging Het
Frem2 A T 3: 53,444,752 (GRCm39) Y2460N probably damaging Het
Gm3604 A T 13: 62,517,868 (GRCm39) C163* probably null Het
Gpalpp1 A C 14: 76,336,063 (GRCm39) probably null Het
Grid2ip A G 5: 143,373,933 (GRCm39) I858V probably damaging Het
Grin2b ATTGTTGT ATTGT 6: 135,709,453 (GRCm39) probably benign Het
Hps4 A G 5: 112,512,429 (GRCm39) T182A probably damaging Het
Impa1 A T 3: 10,394,075 (GRCm39) probably null Het
Kcnh3 T C 15: 99,131,862 (GRCm39) S606P probably damaging Het
Kif23 T A 9: 61,839,193 (GRCm39) R301* probably null Het
Lcp2 G T 11: 34,040,670 (GRCm39) A529S probably benign Het
Lhx8 G A 3: 154,035,925 (GRCm39) A22V probably benign Het
Lin28a A T 4: 133,735,235 (GRCm39) S134T possibly damaging Het
Med27 T A 2: 29,236,882 (GRCm39) V9E possibly damaging Het
Mmp7 C A 9: 7,692,219 (GRCm39) S31R probably benign Het
Mtcl1 T G 17: 66,650,829 (GRCm39) E1545D probably benign Het
Muc16 A G 9: 18,409,126 (GRCm39) Y187H probably damaging Het
Myo3a G T 2: 22,404,679 (GRCm39) K678N possibly damaging Het
Nsmce1 T C 7: 125,085,645 (GRCm39) M15V probably benign Het
Nxpe3 A T 16: 55,670,078 (GRCm39) N342K probably damaging Het
Or7g25 A G 9: 19,160,495 (GRCm39) S67P probably damaging Het
Or8g2 T A 9: 39,821,756 (GRCm39) I219N probably damaging Het
Pcdhb9 A G 18: 37,534,663 (GRCm39) N219S probably benign Het
Pck2 T A 14: 55,781,449 (GRCm39) V190E probably damaging Het
Pde4b G A 4: 102,456,840 (GRCm39) A429T probably damaging Het
Phf1 T C 17: 27,153,429 (GRCm39) V54A probably damaging Het
Pla2r1 T C 2: 60,353,127 (GRCm39) E278G probably damaging Het
Ptges3 G T 10: 127,908,016 (GRCm39) R122L probably benign Het
Rnpepl1 C T 1: 92,844,881 (GRCm39) T391I probably damaging Het
Rps6kb1 G A 11: 86,397,633 (GRCm39) A404V probably benign Het
Rrm2b T C 15: 37,945,391 (GRCm39) probably null Het
Sh3rf1 C T 8: 61,679,321 (GRCm39) P121L probably benign Het
Skint9 T G 4: 112,248,148 (GRCm39) I199L probably benign Het
Slc9b2 G T 3: 135,042,290 (GRCm39) R523L probably benign Het
Slco1c1 T A 6: 141,477,174 (GRCm39) probably null Het
Stox2 T C 8: 47,645,865 (GRCm39) T532A probably damaging Het
Tbcel A G 9: 42,327,248 (GRCm39) L385P probably damaging Het
Tle5 A G 10: 81,401,474 (GRCm39) N181D probably benign Het
Tmem268 G A 4: 63,496,149 (GRCm39) probably null Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Top3a G A 11: 60,650,182 (GRCm39) T122M probably damaging Het
Trav7n-4 G A 14: 53,329,088 (GRCm39) V33I probably benign Het
Ttn T G 2: 76,539,551 (GRCm39) E26151D possibly damaging Het
Ttn C T 2: 76,687,228 (GRCm39) probably benign Het
Tyk2 A G 9: 21,035,328 (GRCm39) C195R possibly damaging Het
Ugt2b38 T C 5: 87,558,078 (GRCm39) K528E probably damaging Het
Usp28 T A 9: 48,937,125 (GRCm39) D483E probably benign Het
Vldlr A G 19: 27,220,554 (GRCm39) D598G probably damaging Het
Vmn1r51 T G 6: 90,106,498 (GRCm39) I138S probably damaging Het
Vps13b G A 15: 35,869,541 (GRCm39) A2682T probably damaging Het
Wac T A 18: 7,917,568 (GRCm39) V346E probably damaging Het
Zdbf2 T C 1: 63,347,579 (GRCm39) V1986A possibly damaging Het
Other mutations in Kirrel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Kirrel1 APN 3 86,997,182 (GRCm39) missense probably benign 0.22
IGL01865:Kirrel1 APN 3 86,993,731 (GRCm39) missense probably damaging 1.00
IGL01875:Kirrel1 APN 3 87,003,037 (GRCm39) missense probably damaging 1.00
IGL02337:Kirrel1 APN 3 86,996,519 (GRCm39) missense possibly damaging 0.64
IGL02724:Kirrel1 APN 3 86,997,780 (GRCm39) nonsense probably null
IGL02825:Kirrel1 APN 3 86,996,595 (GRCm39) splice site probably benign
IGL02826:Kirrel1 APN 3 86,995,792 (GRCm39) missense probably damaging 1.00
IGL03102:Kirrel1 APN 3 86,990,807 (GRCm39) missense probably damaging 0.98
D4043:Kirrel1 UTSW 3 86,990,510 (GRCm39) missense probably benign 0.02
R0360:Kirrel1 UTSW 3 86,997,106 (GRCm39) missense probably damaging 1.00
R0364:Kirrel1 UTSW 3 86,997,106 (GRCm39) missense probably damaging 1.00
R0421:Kirrel1 UTSW 3 86,990,914 (GRCm39) missense probably damaging 0.99
R0503:Kirrel1 UTSW 3 87,005,109 (GRCm39) missense probably benign 0.20
R1112:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1116:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1144:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1147:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1147:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1190:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1226:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1501:Kirrel1 UTSW 3 86,997,779 (GRCm39) missense probably benign 0.02
R1538:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1546:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1628:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1630:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1631:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1664:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1671:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1695:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1769:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1807:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1808:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1840:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1876:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R1995:Kirrel1 UTSW 3 87,003,093 (GRCm39) missense possibly damaging 0.88
R2014:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2086:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2108:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2354:Kirrel1 UTSW 3 86,995,792 (GRCm39) missense probably damaging 0.98
R2407:Kirrel1 UTSW 3 86,992,150 (GRCm39) missense probably benign 0.03
R2904:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2905:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2958:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2959:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2960:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R2961:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3026:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3028:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3034:Kirrel1 UTSW 3 86,990,746 (GRCm39) missense possibly damaging 0.56
R3149:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3195:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3499:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3699:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3720:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3721:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3788:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3793:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3876:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3877:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3901:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3910:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3911:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3912:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3913:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3930:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R3931:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4022:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4067:Kirrel1 UTSW 3 86,995,774 (GRCm39) nonsense probably null
R4077:Kirrel1 UTSW 3 86,992,387 (GRCm39) critical splice donor site probably null
R4198:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4328:Kirrel1 UTSW 3 86,992,081 (GRCm39) intron probably benign
R4355:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4363:Kirrel1 UTSW 3 86,997,792 (GRCm39) nonsense probably null
R4378:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4386:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4460:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4468:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4469:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4650:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4652:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4734:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4748:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R4749:Kirrel1 UTSW 3 86,996,458 (GRCm39) missense probably null 0.46
R5304:Kirrel1 UTSW 3 86,996,902 (GRCm39) missense probably benign 0.02
R5534:Kirrel1 UTSW 3 86,997,825 (GRCm39) missense probably damaging 1.00
R5604:Kirrel1 UTSW 3 86,996,462 (GRCm39) missense possibly damaging 0.69
R7199:Kirrel1 UTSW 3 86,990,695 (GRCm39) missense probably benign 0.02
R7221:Kirrel1 UTSW 3 86,993,704 (GRCm39) nonsense probably null
R7284:Kirrel1 UTSW 3 86,990,694 (GRCm39) missense probably benign 0.02
R7332:Kirrel1 UTSW 3 86,995,705 (GRCm39) missense probably benign 0.14
R7369:Kirrel1 UTSW 3 87,048,391 (GRCm39) missense probably benign 0.20
R7371:Kirrel1 UTSW 3 86,995,729 (GRCm39) missense probably benign 0.44
R7508:Kirrel1 UTSW 3 86,990,746 (GRCm39) missense possibly damaging 0.56
R7566:Kirrel1 UTSW 3 86,995,791 (GRCm39) missense probably damaging 1.00
R7567:Kirrel1 UTSW 3 87,002,988 (GRCm39) missense probably damaging 0.99
R7621:Kirrel1 UTSW 3 86,995,528 (GRCm39) missense possibly damaging 0.70
R8030:Kirrel1 UTSW 3 87,005,082 (GRCm39) missense probably damaging 1.00
R8141:Kirrel1 UTSW 3 86,993,735 (GRCm39) nonsense probably null
R8261:Kirrel1 UTSW 3 86,995,309 (GRCm39) intron probably benign
R8477:Kirrel1 UTSW 3 86,992,138 (GRCm39) missense possibly damaging 0.71
R8512:Kirrel1 UTSW 3 86,995,534 (GRCm39) missense probably benign 0.00
R8954:Kirrel1 UTSW 3 86,997,173 (GRCm39) missense probably benign 0.25
R8987:Kirrel1 UTSW 3 86,992,400 (GRCm39) missense probably damaging 1.00
R9058:Kirrel1 UTSW 3 86,992,442 (GRCm39) missense probably benign 0.18
R9146:Kirrel1 UTSW 3 87,003,015 (GRCm39) missense probably damaging 1.00
R9311:Kirrel1 UTSW 3 87,005,123 (GRCm39) missense probably benign 0.29
R9527:Kirrel1 UTSW 3 86,996,912 (GRCm39) nonsense probably null
R9629:Kirrel1 UTSW 3 87,003,025 (GRCm39) nonsense probably null
Z1177:Kirrel1 UTSW 3 86,991,182 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCCTGAGTTCTATGCAAGTC -3'
(R):5'- AGCTGATGATTCTCAGGCACC -3'

Sequencing Primer
(F):5'- TATGGCTGACTGCAAGTACC -3'
(R):5'- TCAGGCACCTGAGACTCTGAC -3'
Posted On 2015-02-18