Incidental Mutation 'R3412:Gria4'
ID267772
Institutional Source Beutler Lab
Gene Symbol Gria4
Ensembl Gene ENSMUSG00000025892
Gene Nameglutamate receptor, ionotropic, AMPA4 (alpha 4)
SynonymsGluralpha4, spkw1, Glur4, Glur-4
MMRRC Submission 040630-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.615) question?
Stock #R3412 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location4417896-4796234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4513278 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 277 (D277V)
Ref Sequence ENSEMBL: ENSMUSP00000129316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000163309] [ENSMUST00000212533]
Predicted Effect probably benign
Transcript: ENSMUST00000027020
AA Change: D277V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: D277V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3e-61 PFAM
PBPe 416 791 8.23e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063508
AA Change: D277V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: D277V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 2.5e-71 PFAM
PBPe 416 791 2.06e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163309
AA Change: D277V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000129316
Gene: ENSMUSG00000025892
AA Change: D277V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212533
AA Change: D277V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 T C 13: 8,752,618 F643S probably damaging Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Arhgef5 A G 6: 43,273,790 I492V probably benign Het
Atp8b4 C A 2: 126,375,757 W613L probably damaging Het
Ccdc162 T C 10: 41,539,549 probably benign Het
Diexf A C 1: 193,128,502 S64R possibly damaging Het
Esp24 T A 17: 39,038,316 I11N possibly damaging Het
Exoc4 A G 6: 33,265,975 E41G probably damaging Het
Eya1 T A 1: 14,274,209 probably null Het
Gckr T A 5: 31,300,867 probably null Het
Gm4981 G A 10: 58,236,353 T13I possibly damaging Het
Il18r1 A T 1: 40,491,067 D318V probably damaging Het
Il4i1 T C 7: 44,836,658 L22P probably damaging Het
Inpp5d C A 1: 87,668,057 T175N possibly damaging Het
Krt90 T A 15: 101,560,593 L171F probably damaging Het
Mthfd1 A G 12: 76,303,749 probably null Het
Olfr262 T C 19: 12,241,590 I24V probably benign Het
Olfr561 T C 7: 102,774,755 L77P possibly damaging Het
Olfr635 T C 7: 103,979,402 L76P probably damaging Het
Olfr786 A T 10: 129,437,307 D165V probably damaging Het
Pla2g4f T C 2: 120,303,106 S579G probably benign Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Prss43 G C 9: 110,829,464 Q277H probably damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc12a5 A G 2: 164,968,431 D10G probably benign Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Sos1 T C 17: 80,406,717 D1108G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Tacc2 A G 7: 130,734,994 T2369A probably benign Het
Taok2 T C 7: 126,870,858 I933V possibly damaging Het
Tex9 C A 9: 72,477,758 Q265H possibly damaging Het
Trim69 T C 2: 122,178,644 V395A probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubr5 T C 15: 38,004,235 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Gria4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Gria4 APN 9 4472202 missense probably damaging 0.98
IGL01451:Gria4 APN 9 4503652 missense probably benign 0.04
IGL01533:Gria4 APN 9 4502395 missense probably damaging 1.00
IGL01994:Gria4 APN 9 4537726 missense probably damaging 1.00
IGL02078:Gria4 APN 9 4793878 missense probably damaging 0.98
IGL02183:Gria4 APN 9 4502460 missense probably damaging 1.00
IGL02351:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL02358:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL03118:Gria4 APN 9 4793804 splice site probably benign
IGL03131:Gria4 APN 9 4432876 missense probably damaging 0.96
IGL03148:Gria4 APN 9 4464295 missense possibly damaging 0.91
IGL03264:Gria4 APN 9 4513288 missense probably benign
PIT4812001:Gria4 UTSW 9 4427128 missense probably damaging 1.00
R0018:Gria4 UTSW 9 4432843 missense possibly damaging 0.71
R0295:Gria4 UTSW 9 4793840 missense possibly damaging 0.69
R0654:Gria4 UTSW 9 4464372 missense probably benign 0.32
R0690:Gria4 UTSW 9 4427071 missense probably damaging 1.00
R0992:Gria4 UTSW 9 4795238 missense probably benign
R1517:Gria4 UTSW 9 4793865 missense probably damaging 1.00
R1673:Gria4 UTSW 9 4537637 nonsense probably null
R1713:Gria4 UTSW 9 4424448 missense probably benign 0.20
R1961:Gria4 UTSW 9 4519546 splice site probably benign
R2137:Gria4 UTSW 9 4427026 intron probably benign
R2397:Gria4 UTSW 9 4537717 missense probably damaging 1.00
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R3014:Gria4 UTSW 9 4464294 missense probably damaging 0.97
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3733:Gria4 UTSW 9 4513295 missense probably benign
R3897:Gria4 UTSW 9 4513260 missense probably damaging 1.00
R4404:Gria4 UTSW 9 4464489 splice site probably null
R4457:Gria4 UTSW 9 4427074 missense probably damaging 1.00
R4672:Gria4 UTSW 9 4664981 missense possibly damaging 0.96
R4865:Gria4 UTSW 9 4464295 missense possibly damaging 0.91
R5092:Gria4 UTSW 9 4472176 missense probably benign 0.01
R5109:Gria4 UTSW 9 4472168 missense probably damaging 1.00
R5202:Gria4 UTSW 9 4424330 missense probably benign 0.10
R5828:Gria4 UTSW 9 4432832 missense probably damaging 1.00
R5945:Gria4 UTSW 9 4456122 missense probably damaging 1.00
R5985:Gria4 UTSW 9 4503593 missense probably damaging 0.99
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6111:Gria4 UTSW 9 4502430 missense probably damaging 1.00
R6190:Gria4 UTSW 9 4420199 missense probably benign
R6280:Gria4 UTSW 9 4456072 missense probably damaging 1.00
R6406:Gria4 UTSW 9 4427077 missense probably damaging 1.00
R6470:Gria4 UTSW 9 4503680 missense probably damaging 1.00
R6485:Gria4 UTSW 9 4464249 missense probably damaging 1.00
R6612:Gria4 UTSW 9 4472206 missense possibly damaging 0.93
R6848:Gria4 UTSW 9 4793822 missense probably damaging 1.00
R7046:Gria4 UTSW 9 4420278 missense probably damaging 0.97
R7210:Gria4 UTSW 9 4464135 missense probably damaging 1.00
R7284:Gria4 UTSW 9 4472017 missense probably damaging 1.00
R7475:Gria4 UTSW 9 4513330 missense probably damaging 1.00
X0023:Gria4 UTSW 9 4427067 missense probably damaging 1.00
X0065:Gria4 UTSW 9 4464340 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTGGCTTGGCAGTTAAGAAAAC -3'
(R):5'- AACCTATACACTGTTGAAGAAGAGG -3'

Sequencing Primer
(F):5'- TGCTCTTCCAAAGGTCCAGAG -3'
(R):5'- TGGAGGAGCAAATGTCAC -3'
Posted On2015-02-18