Incidental Mutation 'R3413:Map1s'
ID267811
Institutional Source Beutler Lab
Gene Symbol Map1s
Ensembl Gene ENSMUSG00000019261
Gene Namemicrotubule-associated protein 1S
SynonymsBpy2ip1, Map8, VCY2IP1, 6430517J16Rik, Mtap1s
MMRRC Submission 040631-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3413 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70905932-70917529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70912519 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 107 (N107D)
Ref Sequence ENSEMBL: ENSMUSP00000019405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019405] [ENSMUST00000211910] [ENSMUST00000212227] [ENSMUST00000212511] [ENSMUST00000213001]
Predicted Effect probably damaging
Transcript: ENSMUST00000019405
AA Change: N107D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000019405
Gene: ENSMUSG00000019261
AA Change: N107D

DomainStartEndE-ValueType
low complexity region 1 32 N/A INTRINSIC
low complexity region 125 137 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 208 225 N/A INTRINSIC
SCOP:d1e5da2 237 300 2e-3 SMART
Blast:Lactamase_B 244 475 1e-85 BLAST
low complexity region 536 550 N/A INTRINSIC
low complexity region 597 621 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 698 714 N/A INTRINSIC
low complexity region 715 734 N/A INTRINSIC
low complexity region 735 751 N/A INTRINSIC
low complexity region 774 801 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211880
Predicted Effect probably benign
Transcript: ENSMUST00000211910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212143
Predicted Effect possibly damaging
Transcript: ENSMUST00000212227
AA Change: N107D

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000212511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212823
Predicted Effect probably benign
Transcript: ENSMUST00000213001
AA Change: N165D

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213083
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit defective biogenesis and degradation of autophagosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,987,387 probably benign Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Axin1 A G 17: 26,188,038 H535R probably damaging Het
Ccnb3 T A X: 7,007,801 E846D probably benign Het
Cdca7 G A 2: 72,485,287 G365R probably damaging Het
Clvs2 T A 10: 33,622,971 probably benign Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Ddx42 A G 11: 106,247,810 T812A probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
Got1l1 A G 8: 27,199,836 probably null Het
Hip1 T C 5: 135,422,172 E451G probably damaging Het
Hs6st2 C T X: 51,681,455 V50I possibly damaging Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Mmel1 T A 4: 154,889,586 V361D probably damaging Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nup210 G T 6: 91,025,242 Q755K probably benign Het
Olfr114 A G 17: 37,589,696 V219A probably benign Het
Olfr638 A G 7: 104,003,832 M186V probably damaging Het
Pih1h3b T A X: 140,106,021 N216K possibly damaging Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Sspo C T 6: 48,480,697 R3178C probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syk A G 13: 52,631,739 D327G probably benign Het
Tbc1d8b C T X: 139,713,391 A391V probably benign Het
Tmed9 A G 13: 55,595,574 E173G probably benign Het
Top1mt T C 15: 75,657,176 N573S probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfp92 C T X: 73,420,294 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Map1s
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Map1s APN 8 70906029 unclassified probably benign
IGL01012:Map1s APN 8 70913910 missense probably benign 0.00
IGL01729:Map1s APN 8 70913068 missense probably damaging 1.00
IGL03158:Map1s APN 8 70914734 missense probably damaging 0.97
E0374:Map1s UTSW 8 70906017 unclassified probably benign
R0026:Map1s UTSW 8 70914638 missense probably damaging 1.00
R0172:Map1s UTSW 8 70914968 missense probably benign 0.00
R0571:Map1s UTSW 8 70912907 missense probably damaging 1.00
R0666:Map1s UTSW 8 70914052 missense possibly damaging 0.88
R0904:Map1s UTSW 8 70914188 missense probably damaging 0.96
R1617:Map1s UTSW 8 70913451 missense probably damaging 1.00
R1834:Map1s UTSW 8 70916411 missense probably damaging 0.97
R2134:Map1s UTSW 8 70913882 missense probably benign 0.00
R2143:Map1s UTSW 8 70910964 missense probably damaging 1.00
R3870:Map1s UTSW 8 70917101 missense possibly damaging 0.82
R5555:Map1s UTSW 8 70917107 missense probably damaging 0.97
R5784:Map1s UTSW 8 70914358 missense probably damaging 1.00
R6630:Map1s UTSW 8 70913798 missense probably damaging 1.00
Z1088:Map1s UTSW 8 70916449 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AAAGGGCTAGGTGGGTCTTC -3'
(R):5'- CTTCTCTCACCCTAGAGCACAG -3'

Sequencing Primer
(F):5'- CTTCACAGGAGTCTCACGGTGAAG -3'
(R):5'- CACAGGCTTGGGAAAGGGC -3'
Posted On2015-02-18