Incidental Mutation 'R3413:Axin1'
ID267825
Institutional Source Beutler Lab
Gene Symbol Axin1
Ensembl Gene ENSMUSG00000024182
Gene Nameaxin 1
Synonyms
MMRRC Submission 040631-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3413 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location26138688-26195811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26188038 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 535 (H535R)
Ref Sequence ENSEMBL: ENSMUSP00000132000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074370] [ENSMUST00000118904] [ENSMUST00000163421] [ENSMUST00000168282]
Predicted Effect probably damaging
Transcript: ENSMUST00000074370
AA Change: H535R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073974
Gene: ENSMUSG00000024182
AA Change: H535R

DomainStartEndE-ValueType
Pfam:AXIN1_TNKS_BD 13 85 7.5e-27 PFAM
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 523 3.2e-13 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
low complexity region 713 727 N/A INTRINSIC
DAX 786 868 5.92e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118904
AA Change: H535R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113756
Gene: ENSMUSG00000024182
AA Change: H535R

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163421
AA Change: H535R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132000
Gene: ENSMUSG00000024182
AA Change: H535R

DomainStartEndE-ValueType
RGS 93 216 3.03e-36 SMART
low complexity region 230 241 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
coiled coil region 394 432 N/A INTRINSIC
Pfam:Axin_b-cat_bind 468 502 1.2e-18 PFAM
low complexity region 533 544 N/A INTRINSIC
low complexity region 699 709 N/A INTRINSIC
coiled coil region 712 734 N/A INTRINSIC
DAX 750 832 5.92e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168282
SMART Domains Protein: ENSMUSP00000127182
Gene: ENSMUSG00000024182

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
coiled coil region 126 154 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169268
Meta Mutation Damage Score 0.234 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains a regulation of G-protein signaling (RGS) domain and a dishevelled and axin (DIX) domain. The encoded protein interacts with adenomatosis polyposis coli, catenin beta-1, glycogen synthase kinase 3 beta, protein phosphate 2, and itself. This protein functions as a negative regulator of the wingless-type MMTV integration site family, member 1 (WNT) signaling pathway and can induce apoptosis. The crystal structure of a portion of this protein, alone and in a complex with other proteins, has been resolved. Mutations in this gene have been associated with hepatocellular carcinoma, hepatoblastomas, ovarian endometriod adenocarcinomas, and medullablastomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutant homozygotes die at embryonic day 8-10, exhibiting neuroectodermal defects and axial duplications. Heterozygotes exhibit skeletal, cardiac, and neurological defects including short, bent tails, and deafness with circling behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd13 T C 8: 9,987,387 probably benign Het
Ap2a2 T A 7: 141,598,776 N105K probably benign Het
Ccnb3 T A X: 7,007,801 E846D probably benign Het
Cdca7 G A 2: 72,485,287 G365R probably damaging Het
Clvs2 T A 10: 33,622,971 probably benign Het
Coq10a A G 10: 128,365,129 V93A possibly damaging Het
Ddx42 A G 11: 106,247,810 T812A probably benign Het
Eya1 T A 1: 14,274,209 probably null Het
Fcna G C 2: 25,627,493 P49A probably damaging Het
Gckr T A 5: 31,300,867 probably null Het
Golgb1 A G 16: 36,887,347 K68E probably damaging Het
Got1l1 A G 8: 27,199,836 probably null Het
Hip1 T C 5: 135,422,172 E451G probably damaging Het
Hs6st2 C T X: 51,681,455 V50I possibly damaging Het
Ighv1-23 C T 12: 114,764,467 V112I probably benign Het
Map1s A G 8: 70,912,519 N107D probably damaging Het
Mmel1 T A 4: 154,889,586 V361D probably damaging Het
Myh15 A G 16: 49,138,732 D989G probably benign Het
Myo1g G T 11: 6,517,870 H188Q possibly damaging Het
Nup210 G T 6: 91,025,242 Q755K probably benign Het
Olfr114 A G 17: 37,589,696 V219A probably benign Het
Olfr638 A G 7: 104,003,832 M186V probably damaging Het
Pih1h3b T A X: 140,106,021 N216K possibly damaging Het
Plcz1 C T 6: 140,002,081 R525Q probably damaging Het
Ppef2 T G 5: 92,228,722 S649R probably damaging Het
Rusc2 T G 4: 43,415,935 S414A probably damaging Het
Sez6l A G 5: 112,475,361 L108P possibly damaging Het
Slc1a7 A G 4: 108,010,994 E497G probably benign Het
Spag8 T A 4: 43,651,606 S423C probably damaging Het
Sspo C T 6: 48,480,697 R3178C probably damaging Het
St6galnac1 A G 11: 116,765,856 W486R probably damaging Het
Syk A G 13: 52,631,739 D327G probably benign Het
Tbc1d8b C T X: 139,713,391 A391V probably benign Het
Tmed9 A G 13: 55,595,574 E173G probably benign Het
Top1mt T C 15: 75,657,176 N573S probably benign Het
Tusc1 C A 4: 93,334,936 R162L probably damaging Het
Ubn2 A G 6: 38,498,739 T1211A probably benign Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r63 A G 7: 42,926,982 F469S probably benign Het
Zfp92 C T X: 73,420,294 probably benign Het
Zfyve28 C T 5: 34,199,684 M723I probably benign Het
Zmynd8 A T 2: 165,815,451 M533K probably damaging Het
Other mutations in Axin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Axin1 APN 17 26142805 missense possibly damaging 0.88
IGL00229:Axin1 APN 17 26194072 missense probably damaging 1.00
IGL01141:Axin1 APN 17 26190041 missense probably damaging 0.98
IGL02088:Axin1 APN 17 26188695 missense probably benign 0.05
IGL02413:Axin1 APN 17 26188179 missense probably benign 0.00
R0331:Axin1 UTSW 17 26143107 missense probably damaging 1.00
R0454:Axin1 UTSW 17 26173663 missense probably benign 0.00
R0538:Axin1 UTSW 17 26184241 missense possibly damaging 0.66
R0755:Axin1 UTSW 17 26182506 missense possibly damaging 0.95
R0976:Axin1 UTSW 17 26188086 missense probably damaging 1.00
R1634:Axin1 UTSW 17 26187991 missense probably damaging 0.99
R1950:Axin1 UTSW 17 26193964 missense possibly damaging 0.62
R1965:Axin1 UTSW 17 26184225 missense probably damaging 1.00
R1965:Axin1 UTSW 17 26190228 missense probably damaging 0.97
R2180:Axin1 UTSW 17 26143335 missense probably benign
R3051:Axin1 UTSW 17 26190125 missense probably benign 0.01
R3849:Axin1 UTSW 17 26187797 missense probably benign 0.01
R4530:Axin1 UTSW 17 26188172 missense probably benign 0.09
R4560:Axin1 UTSW 17 26173771 missense probably damaging 1.00
R4764:Axin1 UTSW 17 26173756 missense possibly damaging 0.46
R4976:Axin1 UTSW 17 26194070 missense probably benign 0.42
R4976:Axin1 UTSW 17 26194071 missense probably benign 0.24
R5299:Axin1 UTSW 17 26173734 missense probably damaging 0.99
R5682:Axin1 UTSW 17 26187801 missense probably benign
R5690:Axin1 UTSW 17 26194937 missense probably damaging 1.00
R5722:Axin1 UTSW 17 26182557 missense probably damaging 1.00
R5793:Axin1 UTSW 17 26143308 missense probably damaging 1.00
R6108:Axin1 UTSW 17 26143240 missense probably damaging 0.98
R6282:Axin1 UTSW 17 26143037 missense probably damaging 1.00
R6490:Axin1 UTSW 17 26142994 missense probably damaging 1.00
R7153:Axin1 UTSW 17 26187968 missense probably benign
R7181:Axin1 UTSW 17 26173778 missense probably damaging 1.00
R7456:Axin1 UTSW 17 26143165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATCCTGAGAGCATCCTGGATG -3'
(R):5'- AGGCTGGATCAAGACTCACC -3'

Sequencing Primer
(F):5'- CTGAGAGCATCCTGGATGAGCAC -3'
(R):5'- TGGATCAAGACTCACCCAAAGG -3'
Posted On2015-02-18