Incidental Mutation 'R3428:Slc20a1'
ID267945
Institutional Source Beutler Lab
Gene Symbol Slc20a1
Ensembl Gene ENSMUSG00000027397
Gene Namesolute carrier family 20, member 1
SynonymsPiT-1, Glvr1, Glvr-1
MMRRC Submission 040646-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3428 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location129198764-129211616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129200282 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 149 (N149I)
Ref Sequence ENSEMBL: ENSMUSP00000105944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028880] [ENSMUST00000110315] [ENSMUST00000148988]
Predicted Effect probably benign
Transcript: ENSMUST00000028880
AA Change: N149I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028880
Gene: ENSMUSG00000027397
AA Change: N149I

DomainStartEndE-ValueType
Pfam:PHO4 43 667 1.8e-162 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110315
AA Change: N149I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105944
Gene: ENSMUSG00000027397
AA Change: N149I

DomainStartEndE-ValueType
Pfam:PHO4 43 667 1.3e-132 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144744
Predicted Effect probably benign
Transcript: ENSMUST00000148988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193902
Meta Mutation Damage Score 0.1312 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-phosphate symporter that absorbs phosphate from interstitial fluid for use in cellular functions such as metabolism, signal transduction, and nucleic acid and lipid synthesis. The encoded protein is also a retroviral receptor, causing human cells to be susceptible to infection by gibbon ape leukemia virus, simian sarcoma-associated virus, feline leukemia virus subgroup B, and 10A1 murine leukemia virus.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit mid-gestation lethality associated with abnormal vitelline vasculature, growth retardation, and anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 C A 8: 24,667,604 C110F probably damaging Het
Adamts14 C T 10: 61,224,374 E452K probably benign Het
Adrb3 T C 8: 27,228,181 D80G probably damaging Het
Alg5 T A 3: 54,735,585 M1K probably null Het
Ap1g1 A G 8: 109,843,448 E398G probably damaging Het
Arhgap17 A T 7: 123,323,631 L85Q probably damaging Het
Bbs9 T A 9: 22,567,887 probably benign Het
BC034090 T C 1: 155,241,498 I291M probably benign Het
Bicd1 T C 6: 149,512,902 L371P probably damaging Het
Cand2 A C 6: 115,789,707 R424S probably benign Het
Eng G T 2: 32,657,533 V29F probably damaging Het
Gm5828 T A 1: 16,768,614 noncoding transcript Het
Hspg2 T C 4: 137,555,290 L3447P probably damaging Het
Igtp G A 11: 58,206,593 V197I probably damaging Het
Kmt2a T A 9: 44,848,119 N844I probably benign Het
Lyzl4 T C 9: 121,584,129 I78V probably null Het
Mtg2 A G 2: 180,084,272 H225R possibly damaging Het
Olfr713 G A 7: 107,036,716 R187K probably benign Het
Pfpl T A 19: 12,430,313 S643T probably benign Het
Prelid1 T G 13: 55,322,194 V2G probably benign Het
Psma2 A T 13: 14,616,777 K2N probably benign Het
Sec24d C T 3: 123,343,923 probably benign Het
Setd1a G T 7: 127,785,321 probably benign Het
Slc22a5 A G 11: 53,869,326 V388A probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav6-7-dv9 A G 14: 53,710,331 T97A probably benign Het
Trpv3 A T 11: 73,285,941 Y382F probably damaging Het
Ubr2 T C 17: 46,968,439 Y681C probably damaging Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r125 A G 4: 156,350,141 D74G probably benign Het
Yipf2 T C 9: 21,589,645 probably benign Het
Other mutations in Slc20a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Slc20a1 APN 2 129209226 splice site probably benign
IGL02563:Slc20a1 APN 2 129207684 missense probably benign
R0037:Slc20a1 UTSW 2 129210772 missense probably damaging 1.00
R0514:Slc20a1 UTSW 2 129199891 missense probably damaging 1.00
R1221:Slc20a1 UTSW 2 129208404 missense probably benign 0.44
R2099:Slc20a1 UTSW 2 129207838 missense probably benign 0.00
R2122:Slc20a1 UTSW 2 129199819 missense possibly damaging 0.86
R2261:Slc20a1 UTSW 2 129206474 missense possibly damaging 0.85
R2426:Slc20a1 UTSW 2 129208230 missense probably benign 0.13
R4712:Slc20a1 UTSW 2 129199691 splice site probably benign
R4981:Slc20a1 UTSW 2 129199999 missense probably damaging 1.00
R5213:Slc20a1 UTSW 2 129200509 missense probably damaging 1.00
R5395:Slc20a1 UTSW 2 129208337 missense probably damaging 1.00
R5506:Slc20a1 UTSW 2 129210819 missense probably benign 0.00
R6255:Slc20a1 UTSW 2 129208004 missense probably damaging 0.99
R6266:Slc20a1 UTSW 2 129209894 missense possibly damaging 0.78
R7022:Slc20a1 UTSW 2 129200059 missense probably damaging 0.99
R7091:Slc20a1 UTSW 2 129208272 missense possibly damaging 0.85
R7175:Slc20a1 UTSW 2 129210742 missense probably damaging 1.00
R7250:Slc20a1 UTSW 2 129209924 missense possibly damaging 0.78
X0067:Slc20a1 UTSW 2 129199888 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCGCTCCAGTCTTGAAC -3'
(R):5'- CAAAATGAAGTGTCAGGTCTGG -3'

Sequencing Primer
(F):5'- AGTCTTGAACCTTCTCTCCGCAAG -3'
(R):5'- AAGTACGTTTTTGTTAACAAGACCCC -3'
Posted On2015-02-18