Incidental Mutation 'R3428:Alg5'
List |< first << previous [record 68 of 1308] next >> last >|
ID267947
Institutional Source Beutler Lab
Gene Symbol Alg5
Ensembl Gene ENSMUSG00000036632
Gene Nameasparagine-linked glycosylation 5 (dolichyl-phosphate beta-glucosyltransferase)
Synonyms2600005J22Rik, 1500026A19Rik
MMRRC Submission 040646-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R3428 (G1)
Quality Score85
Status Validated
Chromosome3
Chromosomal Location54735539-54751318 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 54735585 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000119260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029316] [ENSMUST00000044567] [ENSMUST00000141191] [ENSMUST00000153224] [ENSMUST00000154787] [ENSMUST00000155273]
Predicted Effect probably benign
Transcript: ENSMUST00000029316
SMART Domains Protein: ENSMUSP00000029316
Gene: ENSMUSG00000027752

DomainStartEndE-ValueType
Pfam:RNase_PH 31 166 2.3e-29 PFAM
Pfam:RNase_PH_C 191 258 8.9e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000044567
AA Change: M1K
SMART Domains Protein: ENSMUSP00000035879
Gene: ENSMUSG00000036632
AA Change: M1K

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 63 174 2.1e-10 PFAM
Pfam:Glycos_transf_2 68 250 2.9e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140935
Predicted Effect probably null
Transcript: ENSMUST00000141191
AA Change: M1K
SMART Domains Protein: ENSMUSP00000118818
Gene: ENSMUSG00000036632
AA Change: M1K

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150923
Predicted Effect probably benign
Transcript: ENSMUST00000153224
SMART Domains Protein: ENSMUSP00000118780
Gene: ENSMUSG00000027752

DomainStartEndE-ValueType
Pfam:RNase_PH 31 130 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154787
SMART Domains Protein: ENSMUSP00000115876
Gene: ENSMUSG00000027752

DomainStartEndE-ValueType
Pfam:RNase_PH 19 106 5.7e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000155273
AA Change: M1K
SMART Domains Protein: ENSMUSP00000119260
Gene: ENSMUSG00000036632
AA Change: M1K

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198780
Meta Mutation Damage Score 0.616 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 2 family. The encoded protein participates in glucosylation of the oligomannose core in N-linked glycosylation of proteins. The addition of glucose residues to the oligomannose core is necessary to ensure substrate recognition, and therefore, effectual transfer of the oligomannose core to the nascent glycoproteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
PHENOTYPE: Embryos homozygous for an ENU-induced mutation arrest unturned at E9.5 and display no left-right asymmetry. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 C A 8: 24,667,604 C110F probably damaging Het
Adamts14 C T 10: 61,224,374 E452K probably benign Het
Adrb3 T C 8: 27,228,181 D80G probably damaging Het
Ap1g1 A G 8: 109,843,448 E398G probably damaging Het
Arhgap17 A T 7: 123,323,631 L85Q probably damaging Het
Bbs9 T A 9: 22,567,887 probably benign Het
BC034090 T C 1: 155,241,498 I291M probably benign Het
Bicd1 T C 6: 149,512,902 L371P probably damaging Het
Cand2 A C 6: 115,789,707 R424S probably benign Het
Eng G T 2: 32,657,533 V29F probably damaging Het
Gm5828 T A 1: 16,768,614 noncoding transcript Het
Hspg2 T C 4: 137,555,290 L3447P probably damaging Het
Igtp G A 11: 58,206,593 V197I probably damaging Het
Kmt2a T A 9: 44,848,119 N844I probably benign Het
Lyzl4 T C 9: 121,584,129 I78V probably null Het
Mtg2 A G 2: 180,084,272 H225R possibly damaging Het
Olfr713 G A 7: 107,036,716 R187K probably benign Het
Pfpl T A 19: 12,430,313 S643T probably benign Het
Prelid1 T G 13: 55,322,194 V2G probably benign Het
Psma2 A T 13: 14,616,777 K2N probably benign Het
Sec24d C T 3: 123,343,923 probably benign Het
Setd1a G T 7: 127,785,321 probably benign Het
Slc20a1 A T 2: 129,200,282 N149I probably benign Het
Slc22a5 A G 11: 53,869,326 V388A probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav6-7-dv9 A G 14: 53,710,331 T97A probably benign Het
Trpv3 A T 11: 73,285,941 Y382F probably damaging Het
Ubr2 T C 17: 46,968,439 Y681C probably damaging Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r125 A G 4: 156,350,141 D74G probably benign Het
Yipf2 T C 9: 21,589,645 probably benign Het
Other mutations in Alg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Alg5 APN 3 54744719 splice site probably benign
R2008:Alg5 UTSW 3 54746473 missense possibly damaging 0.92
R3547:Alg5 UTSW 3 54749315 missense probably benign 0.15
R4372:Alg5 UTSW 3 54738955 critical splice donor site probably null
R4764:Alg5 UTSW 3 54746473 missense possibly damaging 0.92
R5128:Alg5 UTSW 3 54742137 splice site probably null
R5476:Alg5 UTSW 3 54746598 missense probably benign 0.01
R5638:Alg5 UTSW 3 54738833 missense probably benign 0.22
R6880:Alg5 UTSW 3 54738843 missense probably damaging 1.00
R6897:Alg5 UTSW 3 54748642 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTCCAGGGCTTTGACTTG -3'
(R):5'- CACTCAAATAGGGTTCCAAAGGG -3'

Sequencing Primer
(F):5'- GGCTTTGACTTGCCGCAC -3'
(R):5'- GGATTTCAGGGAATCTGAG -3'
Posted On2015-02-18