Incidental Mutation 'R3428:Sec24d'
ID 267948
Institutional Source Beutler Lab
Gene Symbol Sec24d
Ensembl Gene ENSMUSG00000039234
Gene Name SEC24 homolog D, COPII coat complex component
Synonyms LOC383951, 2310020L09Rik
MMRRC Submission 040646-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3428 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 123061104-123159290 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 123137572 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047923]
AlphaFold Q6NXL1
Predicted Effect probably benign
Transcript: ENSMUST00000047923
SMART Domains Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234

DomainStartEndE-ValueType
low complexity region 46 71 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 136 160 N/A INTRINSIC
low complexity region 197 222 N/A INTRINSIC
low complexity region 238 256 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 360 398 1.8e-16 PFAM
Pfam:Sec23_trunk 437 681 3.6e-88 PFAM
Pfam:Sec23_BS 686 770 2e-20 PFAM
Pfam:Sec23_helical 783 884 1e-27 PFAM
Pfam:Gelsolin 899 974 4.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197291
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 C A 8: 25,157,620 (GRCm39) C110F probably damaging Het
Adamts14 C T 10: 61,060,153 (GRCm39) E452K probably benign Het
Adrb3 T C 8: 27,718,209 (GRCm39) D80G probably damaging Het
Alg5 T A 3: 54,643,006 (GRCm39) M1K probably null Het
Ap1g1 A G 8: 110,570,080 (GRCm39) E398G probably damaging Het
Arhgap17 A T 7: 122,922,854 (GRCm39) L85Q probably damaging Het
Bbs9 T A 9: 22,479,183 (GRCm39) probably benign Het
BC034090 T C 1: 155,117,244 (GRCm39) I291M probably benign Het
Bicd1 T C 6: 149,414,400 (GRCm39) L371P probably damaging Het
Cand2 A C 6: 115,766,668 (GRCm39) R424S probably benign Het
Eng G T 2: 32,547,545 (GRCm39) V29F probably damaging Het
Gm5828 T A 1: 16,838,838 (GRCm39) noncoding transcript Het
Hspg2 T C 4: 137,282,601 (GRCm39) L3447P probably damaging Het
Igtp G A 11: 58,097,419 (GRCm39) V197I probably damaging Het
Kmt2a T A 9: 44,759,416 (GRCm39) N844I probably benign Het
Lyzl4 T C 9: 121,413,195 (GRCm39) I78V probably null Het
Mtg2 A G 2: 179,726,065 (GRCm39) H225R possibly damaging Het
Or10a5 G A 7: 106,635,923 (GRCm39) R187K probably benign Het
Pfpl T A 19: 12,407,677 (GRCm39) S643T probably benign Het
Prelid1 T G 13: 55,470,007 (GRCm39) V2G probably benign Het
Psma2 A T 13: 14,791,362 (GRCm39) K2N probably benign Het
Setd1a G T 7: 127,384,493 (GRCm39) probably benign Het
Slc20a1 A T 2: 129,042,202 (GRCm39) N149I probably benign Het
Slc22a5 A G 11: 53,760,152 (GRCm39) V388A probably benign Het
Tmem181a T A 17: 6,346,061 (GRCm39) L185H probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trav6-7-dv9 A G 14: 53,947,788 (GRCm39) T97A probably benign Het
Trpv3 A T 11: 73,176,767 (GRCm39) Y382F probably damaging Het
Ubr2 T C 17: 47,279,365 (GRCm39) Y681C probably damaging Het
Unc80 G A 1: 66,678,464 (GRCm39) V2082I probably benign Het
Vmn2r125 A G 4: 156,702,436 (GRCm39) D74G probably benign Het
Yipf2 T C 9: 21,500,941 (GRCm39) probably benign Het
Other mutations in Sec24d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Sec24d APN 3 123,143,658 (GRCm39) missense probably benign 0.00
IGL01621:Sec24d APN 3 123,087,807 (GRCm39) critical splice acceptor site probably null
IGL01866:Sec24d APN 3 123,087,244 (GRCm39) nonsense probably null
IGL02064:Sec24d APN 3 123,137,463 (GRCm39) splice site probably benign
IGL02125:Sec24d APN 3 123,152,607 (GRCm39) missense probably damaging 1.00
IGL02173:Sec24d APN 3 123,147,330 (GRCm39) missense probably damaging 1.00
IGL03239:Sec24d APN 3 123,130,138 (GRCm39) missense probably benign 0.00
Scanty UTSW 3 123,148,596 (GRCm39) missense probably damaging 1.00
3-1:Sec24d UTSW 3 123,147,279 (GRCm39) missense possibly damaging 0.94
PIT4531001:Sec24d UTSW 3 123,136,827 (GRCm39) missense probably damaging 1.00
R0008:Sec24d UTSW 3 123,144,525 (GRCm39) splice site probably benign
R0838:Sec24d UTSW 3 123,099,485 (GRCm39) missense probably benign 0.08
R1775:Sec24d UTSW 3 123,130,166 (GRCm39) missense probably damaging 1.00
R1895:Sec24d UTSW 3 123,147,043 (GRCm39) missense probably benign 0.04
R1946:Sec24d UTSW 3 123,147,043 (GRCm39) missense probably benign 0.04
R2238:Sec24d UTSW 3 123,143,543 (GRCm39) splice site probably null
R2504:Sec24d UTSW 3 123,147,255 (GRCm39) missense possibly damaging 0.69
R2846:Sec24d UTSW 3 123,144,395 (GRCm39) missense probably damaging 0.98
R2895:Sec24d UTSW 3 123,136,800 (GRCm39) missense probably damaging 1.00
R4573:Sec24d UTSW 3 123,152,519 (GRCm39) missense probably damaging 1.00
R4668:Sec24d UTSW 3 123,149,423 (GRCm39) missense probably damaging 0.98
R4706:Sec24d UTSW 3 123,149,427 (GRCm39) missense possibly damaging 0.80
R4896:Sec24d UTSW 3 123,148,596 (GRCm39) missense probably damaging 1.00
R4982:Sec24d UTSW 3 123,093,255 (GRCm39) missense probably benign 0.29
R5030:Sec24d UTSW 3 123,152,550 (GRCm39) missense probably damaging 0.98
R5041:Sec24d UTSW 3 123,087,880 (GRCm39) missense probably damaging 0.96
R5078:Sec24d UTSW 3 123,084,201 (GRCm39) missense probably benign 0.00
R5108:Sec24d UTSW 3 123,099,434 (GRCm39) splice site probably null
R5174:Sec24d UTSW 3 123,158,575 (GRCm39) missense probably damaging 0.99
R5661:Sec24d UTSW 3 123,136,791 (GRCm39) missense possibly damaging 0.95
R5661:Sec24d UTSW 3 123,136,734 (GRCm39) missense probably damaging 1.00
R5775:Sec24d UTSW 3 123,084,109 (GRCm39) missense probably benign 0.00
R5859:Sec24d UTSW 3 123,072,961 (GRCm39) unclassified probably benign
R5944:Sec24d UTSW 3 123,087,230 (GRCm39) missense probably benign 0.01
R6053:Sec24d UTSW 3 123,072,871 (GRCm39) nonsense probably null
R6515:Sec24d UTSW 3 123,136,719 (GRCm39) missense possibly damaging 0.92
R6552:Sec24d UTSW 3 123,084,201 (GRCm39) missense probably benign 0.00
R6557:Sec24d UTSW 3 123,136,736 (GRCm39) missense probably damaging 1.00
R6593:Sec24d UTSW 3 123,147,061 (GRCm39) missense probably damaging 1.00
R6594:Sec24d UTSW 3 123,087,412 (GRCm39) missense probably damaging 1.00
R6842:Sec24d UTSW 3 123,136,868 (GRCm39) missense probably benign 0.00
R7072:Sec24d UTSW 3 123,124,000 (GRCm39) missense probably damaging 1.00
R7481:Sec24d UTSW 3 123,144,412 (GRCm39) missense probably damaging 1.00
R7554:Sec24d UTSW 3 123,149,423 (GRCm39) missense probably damaging 1.00
R8270:Sec24d UTSW 3 123,099,535 (GRCm39) missense possibly damaging 0.90
R8481:Sec24d UTSW 3 123,147,073 (GRCm39) missense probably damaging 1.00
R8713:Sec24d UTSW 3 123,137,541 (GRCm39) missense probably damaging 1.00
R8872:Sec24d UTSW 3 123,148,585 (GRCm39) splice site probably benign
R8922:Sec24d UTSW 3 123,144,488 (GRCm39) missense probably damaging 1.00
R8974:Sec24d UTSW 3 123,099,498 (GRCm39) missense probably damaging 1.00
R9015:Sec24d UTSW 3 123,121,287 (GRCm39) missense probably benign 0.43
R9050:Sec24d UTSW 3 123,144,374 (GRCm39) missense probably benign 0.00
R9065:Sec24d UTSW 3 123,149,452 (GRCm39) missense probably damaging 1.00
R9128:Sec24d UTSW 3 123,087,810 (GRCm39) missense probably benign
R9447:Sec24d UTSW 3 123,084,162 (GRCm39) missense probably benign 0.00
R9701:Sec24d UTSW 3 123,063,321 (GRCm39) missense probably damaging 1.00
R9758:Sec24d UTSW 3 123,136,803 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGAGGCTTGAAACATCAGTG -3'
(R):5'- GCTGAGCTGAAATCCAGACAAC -3'

Sequencing Primer
(F):5'- TGGACCAGATTCCTGAGA -3'
(R):5'- AGACAACATCGGCTGTTCTG -3'
Posted On 2015-02-18