Incidental Mutation 'R3428:Ap1g1'
ID267959
Institutional Source Beutler Lab
Gene Symbol Ap1g1
Ensembl Gene ENSMUSG00000031731
Gene Nameadaptor protein complex AP-1, gamma 1 subunit
SynonymsD8Ertd374e, Adtg, gamma-adaptin
MMRRC Submission 040646-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3428 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location109778554-109864204 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109843448 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 398 (E398G)
Ref Sequence ENSEMBL: ENSMUSP00000090844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034171] [ENSMUST00000093157]
Predicted Effect probably damaging
Transcript: ENSMUST00000034171
AA Change: E395G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034171
Gene: ENSMUSG00000031731
AA Change: E395G

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Adaptin_N 23 574 7.8e-157 PFAM
low complexity region 626 636 N/A INTRINSIC
low complexity region 653 667 N/A INTRINSIC
low complexity region 668 676 N/A INTRINSIC
Alpha_adaptinC2 699 817 6.37e-46 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000093157
AA Change: E398G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000090844
Gene: ENSMUSG00000031731
AA Change: E398G

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Adaptin_N 23 577 1.1e-155 PFAM
low complexity region 629 639 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
low complexity region 671 679 N/A INTRINSIC
Alpha_adaptinC2 702 820 6.37e-46 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172892
Meta Mutation Damage Score 0.0284 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptins are important components of clathrin-coated vesicles transporting ligand-receptor complexes from the plasma membrane or from the trans-Golgi network to lysosomes. The adaptin family of proteins is composed of four classes of molecules named alpha, beta-, beta prime- and gamma- adaptins. Adaptins, together with medium and small subunits, form a heterotetrameric complex called an adaptor, whose role is to promote the formation of clathrin-coated pits and vesicles. The protein encoded by this gene is a gamma-adaptin protein and it belongs to the adaptor complexes large subunits family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit complete embryonic lethality before implantation. Heterozygotes display slow postnatal weight gain, decreased CD4-positive, alpha beta T cell number in the thymus, and decreased body size up to 10 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 C A 8: 24,667,604 C110F probably damaging Het
Adamts14 C T 10: 61,224,374 E452K probably benign Het
Adrb3 T C 8: 27,228,181 D80G probably damaging Het
Alg5 T A 3: 54,735,585 M1K probably null Het
Arhgap17 A T 7: 123,323,631 L85Q probably damaging Het
Bbs9 T A 9: 22,567,887 probably benign Het
BC034090 T C 1: 155,241,498 I291M probably benign Het
Bicd1 T C 6: 149,512,902 L371P probably damaging Het
Cand2 A C 6: 115,789,707 R424S probably benign Het
Eng G T 2: 32,657,533 V29F probably damaging Het
Gm5828 T A 1: 16,768,614 noncoding transcript Het
Hspg2 T C 4: 137,555,290 L3447P probably damaging Het
Igtp G A 11: 58,206,593 V197I probably damaging Het
Kmt2a T A 9: 44,848,119 N844I probably benign Het
Lyzl4 T C 9: 121,584,129 I78V probably null Het
Mtg2 A G 2: 180,084,272 H225R possibly damaging Het
Olfr713 G A 7: 107,036,716 R187K probably benign Het
Pfpl T A 19: 12,430,313 S643T probably benign Het
Prelid1 T G 13: 55,322,194 V2G probably benign Het
Psma2 A T 13: 14,616,777 K2N probably benign Het
Sec24d C T 3: 123,343,923 probably benign Het
Setd1a G T 7: 127,785,321 probably benign Het
Slc20a1 A T 2: 129,200,282 N149I probably benign Het
Slc22a5 A G 11: 53,869,326 V388A probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav6-7-dv9 A G 14: 53,710,331 T97A probably benign Het
Trpv3 A T 11: 73,285,941 Y382F probably damaging Het
Ubr2 T C 17: 46,968,439 Y681C probably damaging Het
Unc80 G A 1: 66,639,305 V2082I probably benign Het
Vmn2r125 A G 4: 156,350,141 D74G probably benign Het
Yipf2 T C 9: 21,589,645 probably benign Het
Other mutations in Ap1g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Ap1g1 APN 8 109832782 missense possibly damaging 0.85
IGL01907:Ap1g1 APN 8 109843343 splice site probably benign
IGL02248:Ap1g1 APN 8 109863433 utr 3 prime probably benign
IGL02548:Ap1g1 APN 8 109849622 missense probably damaging 1.00
Collapse UTSW 8 109828336 critical splice donor site probably null
Deflate UTSW 8 109851132 critical splice donor site probably null
depress UTSW 8 109838920 missense probably damaging 1.00
R0158:Ap1g1 UTSW 8 109855635 missense probably benign 0.00
R0226:Ap1g1 UTSW 8 109855062 missense probably benign 0.39
R0254:Ap1g1 UTSW 8 109803117 missense probably benign 0.01
R0315:Ap1g1 UTSW 8 109819035 missense probably benign
R0380:Ap1g1 UTSW 8 109803164 splice site probably benign
R0471:Ap1g1 UTSW 8 109853643 missense possibly damaging 0.90
R0508:Ap1g1 UTSW 8 109837732 splice site probably benign
R0837:Ap1g1 UTSW 8 109851065 missense probably damaging 1.00
R1025:Ap1g1 UTSW 8 109818939 missense probably benign 0.24
R1700:Ap1g1 UTSW 8 109853612 missense probably damaging 1.00
R1759:Ap1g1 UTSW 8 109833221 missense probably damaging 1.00
R1809:Ap1g1 UTSW 8 109833182 splice site probably benign
R2161:Ap1g1 UTSW 8 109844354 missense probably damaging 1.00
R3772:Ap1g1 UTSW 8 109837786 missense probably damaging 1.00
R3897:Ap1g1 UTSW 8 109854999 missense probably damaging 0.97
R4244:Ap1g1 UTSW 8 109833490 missense probably benign 0.04
R4714:Ap1g1 UTSW 8 109829620 missense probably damaging 0.98
R4736:Ap1g1 UTSW 8 109855082 missense possibly damaging 0.93
R5173:Ap1g1 UTSW 8 109851132 critical splice donor site probably null
R5185:Ap1g1 UTSW 8 109863326 utr 3 prime probably benign
R5435:Ap1g1 UTSW 8 109838920 missense probably damaging 1.00
R5685:Ap1g1 UTSW 8 109837783 missense probably damaging 0.99
R5824:Ap1g1 UTSW 8 109838912 splice site probably null
R5867:Ap1g1 UTSW 8 109818982 missense probably damaging 1.00
R6339:Ap1g1 UTSW 8 109844368 missense possibly damaging 0.85
R6978:Ap1g1 UTSW 8 109828336 critical splice donor site probably null
R7532:Ap1g1 UTSW 8 109860164 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACAGATGTTTATGCCACTGC -3'
(R):5'- TCTCTTCATAATAGGTGTGAGGCTG -3'

Sequencing Primer
(F):5'- ACAGATGTTTATGCCACTGCTTTTG -3'
(R):5'- GGCTACAATTACTTCTAATTCAGTGC -3'
Posted On2015-02-18