Incidental Mutation 'R3429:A2m'
List |< first << previous [record 34 of 1308] next >> last >|
ID267997
Institutional Source Beutler Lab
Gene Symbol A2m
Ensembl Gene ENSMUSG00000030111
Gene Namealpha-2-macroglobulin
SynonymsA2mp
MMRRC Submission 040647-MU
Accession Numbers

NCBI RefSeq: NM_175628.3; MGI:2449119

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3429 (G1)
Quality Score146
Status Validated
Chromosome6
Chromosomal Location121635376-121679227 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 121636290 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000032203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032203] [ENSMUST00000204850]
Predicted Effect probably null
Transcript: ENSMUST00000032203
AA Change: M1K
SMART Domains Protein: ENSMUSP00000032203
Gene: ENSMUSG00000030111
AA Change: M1K

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:A2M_N 134 227 2.1e-20 PFAM
low complexity region 334 347 N/A INTRINSIC
A2M_N_2 465 613 2.04e-31 SMART
low complexity region 722 731 N/A INTRINSIC
A2M 738 828 2.31e-39 SMART
Pfam:Thiol-ester_cl 961 990 4.4e-18 PFAM
Pfam:A2M_comp 1010 1266 1.4e-98 PFAM
A2M_recep 1376 1463 2.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204850
Meta Mutation Damage Score 0.386 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease inhibitor and cytokine transporter. It uses a bait-and-trap mechanism to inhibit a broad spectrum of proteases, including trypsin, thrombin and collagenase. It can also inhibit inflammatory cytokines, and it thus disrupts inflammatory cascades. Mutations in this gene are a cause of alpha-2-macroglobulin deficiency. This gene is implicated in Alzheimer's disease (AD) due to its ability to mediate the clearance and degradation of A-beta, the major component of beta-amyloid deposits. A related pseudogene, which is also located on the p arm of chromosome 12, has been identified. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l2 C A 19: 56,915,806 R683L probably damaging Het
Ankfy1 C T 11: 72,712,154 probably benign Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Asah1 C T 8: 41,351,888 probably benign Het
B4galnt4 T C 7: 141,070,839 L842P probably damaging Het
Bhmt T C 13: 93,627,347 E62G probably damaging Het
Btbd10 T A 7: 113,351,809 R25* probably null Het
Cdh5 T A 8: 104,130,968 I342N possibly damaging Het
Clca3a2 T A 3: 144,806,327 E109D probably benign Het
Cntrl T C 2: 35,145,100 L913S probably damaging Het
Col12a1 T A 9: 79,680,311 T1183S probably benign Het
Col6a6 A T 9: 105,777,967 Y852N probably damaging Het
Cpeb2 T C 5: 43,281,230 probably null Het
Cyp2c66 T A 19: 39,163,448 N202K probably damaging Het
Dchs1 A G 7: 105,756,504 V2391A possibly damaging Het
Dgat2 A G 7: 99,157,093 V299A probably benign Het
Dnah6 G A 6: 73,121,814 S2034L possibly damaging Het
E430018J23Rik T C 7: 127,391,742 T358A possibly damaging Het
Eps8l2 G A 7: 141,357,919 probably null Het
Fgg T A 3: 83,012,783 F290I probably damaging Het
Filip1 A T 9: 79,853,670 M194K probably damaging Het
Foxl2 T C 9: 98,955,982 F108L probably damaging Het
Fut1 T C 7: 45,619,374 F196L probably damaging Het
Gm10323 A C 13: 66,854,824 W17G probably damaging Het
Gstz1 T A 12: 87,163,696 probably null Het
Hacd1 T C 2: 14,044,775 probably benign Het
Hmcn2 T A 2: 31,409,144 L2834Q possibly damaging Het
Hs3st3a1 C T 11: 64,436,322 R86W probably benign Het
Krtap1-4 G C 11: 99,583,194 probably benign Het
Lmntd2 A G 7: 141,213,997 V21A probably benign Het
Lonp1 T A 17: 56,618,337 D485V probably damaging Het
Mia2 A G 12: 59,189,641 T1346A possibly damaging Het
Mpp2 T C 11: 102,085,315 T6A probably benign Het
Mycbp2 A T 14: 103,229,430 V1299E probably damaging Het
Myo1d C T 11: 80,682,410 G197E probably damaging Het
Nfib T C 4: 82,498,295 I168V possibly damaging Het
Olfr1209 C T 2: 88,909,466 R309Q probably benign Het
Olfr1226 T A 2: 89,193,273 I254L probably benign Het
Olfr1391 C T 11: 49,328,041 A210V probably benign Het
Olfr1535 A T 13: 21,555,805 C72* probably null Het
Olfr318 T A 11: 58,720,271 Y259F probably damaging Het
Parp3 A T 9: 106,474,723 I150K probably damaging Het
Pnp A G 14: 50,947,986 D49G probably benign Het
Prkcq T C 2: 11,246,970 I206T probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rlf A G 4: 121,150,532 L417P probably benign Het
Scn7a AT ATT 2: 66,700,895 probably null Het
Sgce T A 6: 4,730,008 D72V probably benign Het
Sh3d21 A G 4: 126,162,832 S66P probably benign Het
Sost C G 11: 101,964,039 G148A probably damaging Het
Sybu T C 15: 44,746,458 E138G probably damaging Het
Tas1r2 A G 4: 139,669,575 T742A probably damaging Het
Tet3 A G 6: 83,403,419 V589A probably damaging Het
Tnxb C A 17: 34,672,631 C649* probably null Het
Tnxb A G 17: 34,703,587 Y2458C probably damaging Het
Tsku T C 7: 98,352,539 N195S probably damaging Het
Vmn1r215 T A 13: 23,076,208 N139K probably damaging Het
Zfp106 T C 2: 120,527,063 H1117R probably benign Het
Zfp26 A G 9: 20,441,460 probably benign Het
Zfp804b T A 5: 7,180,625 probably benign Het
Zfr T C 15: 12,152,920 S546P probably benign Het
Other mutations in A2m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:A2m APN 6 121644149 missense possibly damaging 0.67
IGL00798:A2m APN 6 121671010 missense probably damaging 1.00
IGL01154:A2m APN 6 121673542 nonsense probably null
IGL01313:A2m APN 6 121645010 critical splice donor site probably null
IGL01337:A2m APN 6 121668570 missense probably damaging 0.98
IGL01505:A2m APN 6 121676947 missense possibly damaging 0.83
IGL01508:A2m APN 6 121659367 nonsense probably null
IGL01672:A2m APN 6 121641357 missense probably damaging 1.00
IGL01951:A2m APN 6 121667190 missense possibly damaging 0.78
IGL02012:A2m APN 6 121674861 missense probably damaging 1.00
IGL02066:A2m APN 6 121649895 missense probably damaging 1.00
IGL02234:A2m APN 6 121668220 missense possibly damaging 0.67
IGL02397:A2m APN 6 121646875 missense probably benign
IGL02407:A2m APN 6 121668616 nonsense probably null
IGL02408:A2m APN 6 121644171 missense probably damaging 0.99
IGL02469:A2m APN 6 121668115 missense probably damaging 1.00
IGL02527:A2m APN 6 121661433 missense probably damaging 0.99
IGL02612:A2m APN 6 121678012 missense probably benign
IGL02746:A2m APN 6 121669503 splice site probably benign
IGL02952:A2m APN 6 121678025 missense probably damaging 0.99
IGL03056:A2m APN 6 121670903 missense probably damaging 0.96
IGL03121:A2m APN 6 121641306 missense probably benign 0.02
IGL03303:A2m APN 6 121667163 missense probably damaging 1.00
IGL03369:A2m APN 6 121676903 critical splice acceptor site probably null
IGL03046:A2m UTSW 6 121659323 missense probably benign 0.04
R0040:A2m UTSW 6 121645206 missense possibly damaging 0.93
R0049:A2m UTSW 6 121638308 missense possibly damaging 0.77
R0049:A2m UTSW 6 121638308 missense possibly damaging 0.77
R0109:A2m UTSW 6 121659303 missense probably benign 0.00
R0147:A2m UTSW 6 121662446 critical splice donor site probably null
R0148:A2m UTSW 6 121662446 critical splice donor site probably null
R0345:A2m UTSW 6 121638272 splice site probably benign
R0445:A2m UTSW 6 121657955 missense probably damaging 1.00
R0766:A2m UTSW 6 121676890 splice site probably benign
R1186:A2m UTSW 6 121661534 missense probably benign 0.00
R1436:A2m UTSW 6 121644213 missense probably benign 0.09
R1452:A2m UTSW 6 121678056 missense probably benign 0.01
R1636:A2m UTSW 6 121654612 missense probably benign 0.04
R1637:A2m UTSW 6 121654612 missense probably benign 0.04
R1638:A2m UTSW 6 121654612 missense probably benign 0.04
R1698:A2m UTSW 6 121645158 missense possibly damaging 0.88
R1776:A2m UTSW 6 121641424 missense probably damaging 1.00
R1791:A2m UTSW 6 121654612 missense probably benign 0.04
R1918:A2m UTSW 6 121644936 missense probably benign 0.16
R1921:A2m UTSW 6 121654612 missense probably benign 0.04
R1927:A2m UTSW 6 121636379 missense probably damaging 1.00
R1934:A2m UTSW 6 121649833 missense probably damaging 0.98
R1943:A2m UTSW 6 121668547 missense possibly damaging 0.90
R1996:A2m UTSW 6 121669597 missense probably damaging 1.00
R2039:A2m UTSW 6 121659949 missense probably benign 0.32
R2085:A2m UTSW 6 121676959 missense probably damaging 1.00
R2092:A2m UTSW 6 121674937 nonsense probably null
R2105:A2m UTSW 6 121673500 missense probably benign 0.04
R2107:A2m UTSW 6 121654612 missense probably benign 0.04
R2235:A2m UTSW 6 121642064 missense probably benign 0.21
R2292:A2m UTSW 6 121673559 missense possibly damaging 0.90
R2350:A2m UTSW 6 121678088 splice site probably benign
R3001:A2m UTSW 6 121661447 missense possibly damaging 0.88
R3002:A2m UTSW 6 121661447 missense possibly damaging 0.88
R3023:A2m UTSW 6 121669572 missense probably benign 0.08
R3437:A2m UTSW 6 121639294 unclassified probably null
R3909:A2m UTSW 6 121648166 missense probably damaging 1.00
R4300:A2m UTSW 6 121673475 missense probably benign 0.00
R4332:A2m UTSW 6 121657447 missense probably benign 0.01
R4584:A2m UTSW 6 121657406 missense probably benign 0.07
R4697:A2m UTSW 6 121638284 start codon destroyed probably null 0.94
R4710:A2m UTSW 6 121641303 missense probably benign 0.03
R4841:A2m UTSW 6 121646844 missense probably benign 0.06
R5206:A2m UTSW 6 121674807 missense probably damaging 1.00
R5219:A2m UTSW 6 121676950 missense possibly damaging 0.90
R5230:A2m UTSW 6 121674861 missense probably damaging 1.00
R5330:A2m UTSW 6 121638416 missense probably benign 0.11
R5331:A2m UTSW 6 121638416 missense probably benign 0.11
R5377:A2m UTSW 6 121645253 missense probably benign
R5590:A2m UTSW 6 121676932 missense probably damaging 1.00
R5835:A2m UTSW 6 121639336 missense probably damaging 1.00
R5910:A2m UTSW 6 121668117 missense probably damaging 1.00
R5915:A2m UTSW 6 121667163 missense probably damaging 1.00
R5949:A2m UTSW 6 121678073 missense probably damaging 1.00
R5994:A2m UTSW 6 121670903 missense probably benign 0.38
R5996:A2m UTSW 6 121659394 missense probably damaging 1.00
R6035:A2m UTSW 6 121638394 missense probably damaging 0.99
R6035:A2m UTSW 6 121638394 missense probably damaging 0.99
R6090:A2m UTSW 6 121648013 missense probably benign 0.45
R6241:A2m UTSW 6 121646829 missense probably benign 0.09
R6294:A2m UTSW 6 121654481 missense probably benign
R6492:A2m UTSW 6 121654505 missense probably benign 0.35
R6554:A2m UTSW 6 121641287 missense probably damaging 1.00
R6597:A2m UTSW 6 121648121 missense probably damaging 1.00
R6742:A2m UTSW 6 121678036 missense probably benign 0.01
R6795:A2m UTSW 6 121648322 intron probably null
R6843:A2m UTSW 6 121638401 missense probably benign 0.01
X0057:A2m UTSW 6 121668176 missense probably damaging 1.00
X0060:A2m UTSW 6 121676080 missense probably damaging 1.00
X0063:A2m UTSW 6 121646876 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCATCAATGACCCCTTCAGAG -3'
(R):5'- TTGTACAAATCTCGGCGCTC -3'

Sequencing Primer
(F):5'- ATGACCCCTTCAGAGAATGTTC -3'
(R):5'- TGTACAAATCTCGGCGCTCTAAGG -3'
Posted On2015-02-18