Incidental Mutation 'R3429:Parp3'
ID268015
Institutional Source Beutler Lab
Gene Symbol Parp3
Ensembl Gene ENSMUSG00000023249
Gene Namepoly (ADP-ribose) polymerase family, member 3
SynonymsA930002C11Rik, PARP-3, Adprt3, Adprtl3
MMRRC Submission 040647-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3429 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location106470322-106476949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106474723 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 150 (I150K)
Ref Sequence ENSEMBL: ENSMUSP00000117329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047721] [ENSMUST00000067218] [ENSMUST00000112479] [ENSMUST00000123555] [ENSMUST00000125850] [ENSMUST00000156426] [ENSMUST00000214682]
Predicted Effect probably benign
Transcript: ENSMUST00000047721
SMART Domains Protein: ENSMUSP00000038580
Gene: ENSMUSG00000041506

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
low complexity region 47 57 N/A INTRINSIC
coiled coil region 61 102 N/A INTRINSIC
WD40 135 174 1.15e-4 SMART
WD40 177 227 3.09e-5 SMART
WD40 230 269 2.42e-7 SMART
WD40 272 311 9.24e-4 SMART
WD40 313 351 2.4e-2 SMART
WD40 354 404 4.6e0 SMART
Blast:WD40 412 451 1e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000067218
AA Change: I150K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000064513
Gene: ENSMUSG00000023249
AA Change: I150K

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
Pfam:PARP_reg 176 315 8.7e-39 PFAM
Pfam:PARP 317 528 7.1e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112479
AA Change: I150K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108098
Gene: ENSMUSG00000023249
AA Change: I150K

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
Pfam:PARP_reg 182 319 1.3e-42 PFAM
Pfam:PARP 322 533 7.3e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123464
Predicted Effect probably damaging
Transcript: ENSMUST00000123555
AA Change: I150K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123054
Gene: ENSMUSG00000023249
AA Change: I150K

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
Pfam:PARP_reg 176 315 8.7e-39 PFAM
Pfam:PARP 317 528 7.1e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125630
Predicted Effect possibly damaging
Transcript: ENSMUST00000125850
AA Change: I150K

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119244
Gene: ENSMUSG00000023249
AA Change: I150K

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145396
Predicted Effect probably damaging
Transcript: ENSMUST00000156426
AA Change: I150K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117329
Gene: ENSMUSG00000023249
AA Change: I150K

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
PDB:4L7U|A 179 202 6e-7 PDB
SCOP:d1a26_1 182 202 5e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000214682
AA Change: I150K

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217303
Meta Mutation Damage Score 0.0224 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PARP family. These enzymes modify nuclear proteins by poly-ADP-ribosylation, which is required for DNA repair, regulation of apoptosis, and maintenance of genomic stability. This gene encodes the poly(ADP-ribosyl)transferase 3, which is preferentially localized to the daughter centriole throughout the cell cycle. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,636,290 M1K probably null Het
Afap1l2 C A 19: 56,915,806 R683L probably damaging Het
Ankfy1 C T 11: 72,712,154 probably benign Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Asah1 C T 8: 41,351,888 probably benign Het
B4galnt4 T C 7: 141,070,839 L842P probably damaging Het
Bhmt T C 13: 93,627,347 E62G probably damaging Het
Btbd10 T A 7: 113,351,809 R25* probably null Het
Cdh5 T A 8: 104,130,968 I342N possibly damaging Het
Clca3a2 T A 3: 144,806,327 E109D probably benign Het
Cntrl T C 2: 35,145,100 L913S probably damaging Het
Col12a1 T A 9: 79,680,311 T1183S probably benign Het
Col6a6 A T 9: 105,777,967 Y852N probably damaging Het
Cpeb2 T C 5: 43,281,230 probably null Het
Cyp2c66 T A 19: 39,163,448 N202K probably damaging Het
Dchs1 A G 7: 105,756,504 V2391A possibly damaging Het
Dgat2 A G 7: 99,157,093 V299A probably benign Het
Dnah6 G A 6: 73,121,814 S2034L possibly damaging Het
E430018J23Rik T C 7: 127,391,742 T358A possibly damaging Het
Eps8l2 G A 7: 141,357,919 probably null Het
Fgg T A 3: 83,012,783 F290I probably damaging Het
Filip1 A T 9: 79,853,670 M194K probably damaging Het
Foxl2 T C 9: 98,955,982 F108L probably damaging Het
Fut1 T C 7: 45,619,374 F196L probably damaging Het
Gm10323 A C 13: 66,854,824 W17G probably damaging Het
Gstz1 T A 12: 87,163,696 probably null Het
Hacd1 T C 2: 14,044,775 probably benign Het
Hmcn2 T A 2: 31,409,144 L2834Q possibly damaging Het
Hs3st3a1 C T 11: 64,436,322 R86W probably benign Het
Krtap1-4 G C 11: 99,583,194 probably benign Het
Lmntd2 A G 7: 141,213,997 V21A probably benign Het
Lonp1 T A 17: 56,618,337 D485V probably damaging Het
Mia2 A G 12: 59,189,641 T1346A possibly damaging Het
Mpp2 T C 11: 102,085,315 T6A probably benign Het
Mycbp2 A T 14: 103,229,430 V1299E probably damaging Het
Myo1d C T 11: 80,682,410 G197E probably damaging Het
Nfib T C 4: 82,498,295 I168V possibly damaging Het
Olfr1209 C T 2: 88,909,466 R309Q probably benign Het
Olfr1226 T A 2: 89,193,273 I254L probably benign Het
Olfr1391 C T 11: 49,328,041 A210V probably benign Het
Olfr1535 A T 13: 21,555,805 C72* probably null Het
Olfr318 T A 11: 58,720,271 Y259F probably damaging Het
Pnp A G 14: 50,947,986 D49G probably benign Het
Prkcq T C 2: 11,246,970 I206T probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rlf A G 4: 121,150,532 L417P probably benign Het
Scn7a AT ATT 2: 66,700,895 probably null Het
Sgce T A 6: 4,730,008 D72V probably benign Het
Sh3d21 A G 4: 126,162,832 S66P probably benign Het
Sost C G 11: 101,964,039 G148A probably damaging Het
Sybu T C 15: 44,746,458 E138G probably damaging Het
Tas1r2 A G 4: 139,669,575 T742A probably damaging Het
Tet3 A G 6: 83,403,419 V589A probably damaging Het
Tnxb C A 17: 34,672,631 C649* probably null Het
Tnxb A G 17: 34,703,587 Y2458C probably damaging Het
Tsku T C 7: 98,352,539 N195S probably damaging Het
Vmn1r215 T A 13: 23,076,208 N139K probably damaging Het
Zfp106 T C 2: 120,527,063 H1117R probably benign Het
Zfp26 A G 9: 20,441,460 probably benign Het
Zfp804b T A 5: 7,180,625 probably benign Het
Zfr T C 15: 12,152,920 S546P probably benign Het
Other mutations in Parp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Parp3 APN 9 106471387 missense probably benign
IGL00827:Parp3 APN 9 106474406 missense probably benign 0.17
IGL02683:Parp3 APN 9 106473185 missense possibly damaging 0.84
R0050:Parp3 UTSW 9 106471401 missense possibly damaging 0.81
R0110:Parp3 UTSW 9 106471796 missense possibly damaging 0.81
R0320:Parp3 UTSW 9 106475812 missense possibly damaging 0.76
R0510:Parp3 UTSW 9 106471796 missense possibly damaging 0.81
R0989:Parp3 UTSW 9 106473082 splice site probably null
R1170:Parp3 UTSW 9 106476005 intron probably benign
R1919:Parp3 UTSW 9 106475117 missense possibly damaging 0.92
R1935:Parp3 UTSW 9 106474732 missense probably damaging 1.00
R1936:Parp3 UTSW 9 106474732 missense probably damaging 1.00
R1958:Parp3 UTSW 9 106474822 unclassified probably null
R2188:Parp3 UTSW 9 106475852 missense probably damaging 0.99
R2919:Parp3 UTSW 9 106473725 missense possibly damaging 0.84
R3014:Parp3 UTSW 9 106471315 missense possibly damaging 0.66
R3430:Parp3 UTSW 9 106474723 missense probably damaging 0.99
R3618:Parp3 UTSW 9 106475063 missense possibly damaging 0.81
R3980:Parp3 UTSW 9 106474068 missense probably damaging 1.00
R4840:Parp3 UTSW 9 106473109 missense probably damaging 1.00
R5617:Parp3 UTSW 9 106474505 missense possibly damaging 0.75
R6015:Parp3 UTSW 9 106474282 missense possibly damaging 0.72
R6591:Parp3 UTSW 9 106473692 missense probably benign
R6691:Parp3 UTSW 9 106473692 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGTACACCTGGGGAGATAAG -3'
(R):5'- CAAATCTTGCTGGTGGACAC -3'

Sequencing Primer
(F):5'- TGGGGAGATAAGGCCTGCTC -3'
(R):5'- GTGGACACACCCCTGAAAGTTG -3'
Posted On2015-02-18