Incidental Mutation 'R3430:Tbc1d5'
ID268095
Institutional Source Beutler Lab
Gene Symbol Tbc1d5
Ensembl Gene ENSMUSG00000023923
Gene NameTBC1 domain family, member 5
Synonyms1600014N05Rik
MMRRC Submission 040648-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R3430 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location50733124-51179352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50800128 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 467 (K467E)
Ref Sequence ENSEMBL: ENSMUSP00000153172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024717] [ENSMUST00000224528]
Predicted Effect probably damaging
Transcript: ENSMUST00000024717
AA Change: K467E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024717
Gene: ENSMUSG00000023923
AA Change: K467E

DomainStartEndE-ValueType
TBC 78 384 5.56e-86 SMART
low complexity region 475 492 N/A INTRINSIC
SCOP:d1lsha3 511 546 1e-3 SMART
low complexity region 556 568 N/A INTRINSIC
low complexity region 783 802 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224528
AA Change: K467E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225252
Meta Mutation Damage Score 0.326 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T C 2: 173,528,273 Y114H possibly damaging Het
Afap1l2 C A 19: 56,915,806 R683L probably damaging Het
Ahnak A G 19: 9,006,958 I1869V probably benign Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Arhgef19 T C 4: 141,256,800 L777P probably benign Het
Atf7ip A G 6: 136,575,324 probably benign Het
Bhmt T C 13: 93,627,347 E62G probably damaging Het
Bpifa6 A G 2: 153,989,251 I246V probably benign Het
Btbd10 T A 7: 113,351,809 R25* probably null Het
Ccdc88a T A 11: 29,448,033 D255E probably damaging Het
Chd7 T C 4: 8,844,517 V1542A probably damaging Het
Col12a1 T A 9: 79,680,311 T1183S probably benign Het
Col20a1 T A 2: 181,013,285 L1145* probably null Het
Dchs1 A G 7: 105,756,504 V2391A possibly damaging Het
Dgat2 A G 7: 99,157,093 V299A probably benign Het
Dmxl2 T A 9: 54,477,461 N94I possibly damaging Het
Dnah6 G A 6: 73,121,814 S2034L possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Filip1 A T 9: 79,853,670 M194K probably damaging Het
Fut1 T C 7: 45,619,374 F196L probably damaging Het
Gm10323 A C 13: 66,854,824 W17G probably damaging Het
Grin3a C A 4: 49,792,534 V400L probably benign Het
Htr3a T C 9: 48,907,388 N82S probably benign Het
Il23r A C 6: 67,452,474 S295A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama5 T C 2: 180,196,317 K869E probably benign Het
Lce1d A T 3: 92,685,730 probably benign Het
Lkaaear1 T C 2: 181,697,531 D42G probably benign Het
Mapk8ip2 A G 15: 89,457,282 E232G possibly damaging Het
Marf1 A G 16: 14,140,177 probably benign Het
Mpeg1 A T 19: 12,463,128 H650L probably benign Het
Nfib T C 4: 82,498,295 I168V possibly damaging Het
Olfr1209 C T 2: 88,909,466 R309Q probably benign Het
Olfr1507 A G 14: 52,490,425 F180L possibly damaging Het
Olfr1535 A T 13: 21,555,805 C72* probably null Het
Olfr389 A T 11: 73,776,539 S263T probably damaging Het
Olfr918 A T 9: 38,673,139 F102I probably damaging Het
Otx2 T A 14: 48,658,797 K260M probably damaging Het
P2ry12 C T 3: 59,218,027 D76N probably damaging Het
Parp3 A T 9: 106,474,723 I150K probably damaging Het
Prex2 T G 1: 11,149,854 I683S possibly damaging Het
Prss34 A T 17: 25,299,104 K86I probably benign Het
Ptpn20 T A 14: 33,614,528 V108D possibly damaging Het
Rlf A G 4: 121,150,532 L417P probably benign Het
Rsad2 T C 12: 26,456,419 M1V probably null Het
S1pr5 A G 9: 21,245,082 V16A probably benign Het
Scn7a AT ATT 2: 66,700,895 probably null Het
Serpinb3b A T 1: 107,154,695 S280T probably benign Het
Sh3d21 A G 4: 126,162,832 S66P probably benign Het
Sh3yl1 T C 12: 30,959,842 S253P probably benign Het
Smarca2 A G 19: 26,691,349 E916G probably damaging Het
Sptbn1 A G 11: 30,219,686 I14T possibly damaging Het
Supt16 A T 14: 52,175,359 M559K probably benign Het
Tas1r2 A G 4: 139,669,575 T742A probably damaging Het
Tet3 A G 6: 83,403,419 V589A probably damaging Het
Tmem131 A G 1: 36,808,821 probably benign Het
Tmtc3 A G 10: 100,447,575 F706S probably benign Het
Tsku T C 7: 98,352,539 N195S probably damaging Het
Vmn2r85 T A 10: 130,418,889 H642L probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Zfc3h1 A G 10: 115,410,523 probably benign Het
Other mutations in Tbc1d5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Tbc1d5 APN 17 50813798 missense possibly damaging 0.52
IGL01370:Tbc1d5 APN 17 50966727 missense probably benign 0.18
IGL01625:Tbc1d5 APN 17 50917573 missense probably benign 0.27
IGL01935:Tbc1d5 APN 17 50963765 splice site probably benign
IGL02229:Tbc1d5 APN 17 50852600 missense probably damaging 1.00
IGL02811:Tbc1d5 APN 17 50800121 missense probably damaging 0.99
IGL03192:Tbc1d5 APN 17 50984681 splice site probably benign
FR4976:Tbc1d5 UTSW 17 50799931 missense probably benign
FR4976:Tbc1d5 UTSW 17 50799943 missense probably benign 0.01
IGL02796:Tbc1d5 UTSW 17 50966624 missense probably damaging 1.00
R0153:Tbc1d5 UTSW 17 50984687 splice site probably benign
R0326:Tbc1d5 UTSW 17 50966736 missense probably damaging 1.00
R0417:Tbc1d5 UTSW 17 50756705 missense probably benign 0.18
R0481:Tbc1d5 UTSW 17 50919051 missense probably damaging 0.98
R1143:Tbc1d5 UTSW 17 50742059 nonsense probably null
R1533:Tbc1d5 UTSW 17 50920575 missense possibly damaging 0.89
R1543:Tbc1d5 UTSW 17 50935532 missense probably benign 0.32
R2888:Tbc1d5 UTSW 17 50935549 missense probably damaging 1.00
R3153:Tbc1d5 UTSW 17 50968236 missense probably damaging 1.00
R3898:Tbc1d5 UTSW 17 50963744 missense probably damaging 0.98
R4116:Tbc1d5 UTSW 17 50920587 missense probably damaging 1.00
R4352:Tbc1d5 UTSW 17 50782401 missense probably damaging 0.98
R4456:Tbc1d5 UTSW 17 50782341 missense probably damaging 1.00
R4648:Tbc1d5 UTSW 17 50736223 missense probably benign
R4711:Tbc1d5 UTSW 17 50935509 missense probably damaging 0.98
R4754:Tbc1d5 UTSW 17 50800165 missense probably benign 0.03
R5303:Tbc1d5 UTSW 17 50736200 missense probably benign 0.00
R5360:Tbc1d5 UTSW 17 50984632 missense probably benign 0.26
R5443:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5444:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5611:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5658:Tbc1d5 UTSW 17 50813841 missense probably benign 0.18
R5701:Tbc1d5 UTSW 17 50799955 small deletion probably benign
R5921:Tbc1d5 UTSW 17 50963693 missense probably damaging 1.00
R6280:Tbc1d5 UTSW 17 50782310 missense probably benign 0.01
R6628:Tbc1d5 UTSW 17 50736208 missense probably benign
R6705:Tbc1d5 UTSW 17 51025175 start gained probably benign
R6990:Tbc1d5 UTSW 17 50968232 missense probably benign 0.19
Z1088:Tbc1d5 UTSW 17 50963696 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGGCATGCTTTCAGATTTC -3'
(R):5'- TAGCTGACTTAGTAAACAGCCC -3'

Sequencing Primer
(F):5'- GGCATGCTTTCAGATTTCATCAG -3'
(R):5'- AGCTGACTTAGTAAACAGCCCTTTTC -3'
Posted On2015-02-18