Incidental Mutation 'R3431:Tssk4'
ID268129
Institutional Source Beutler Lab
Gene Symbol Tssk4
Ensembl Gene ENSMUSG00000007591
Gene Nametestis-specific serine kinase 4
Synonyms1700020B19Rik, 4933424F08Rik
MMRRC Submission 040649-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R3431 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55650184-55652539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55651695 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 226 (N226S)
Ref Sequence ENSEMBL: ENSMUSP00000154783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007735] [ENSMUST00000164809] [ENSMUST00000226497] [ENSMUST00000226591] [ENSMUST00000227297] [ENSMUST00000228041] [ENSMUST00000228395]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007735
AA Change: N226S

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000007735
Gene: ENSMUSG00000007591
AA Change: N226S

DomainStartEndE-ValueType
Pfam:Pkinase 25 280 1.1e-54 PFAM
Pfam:Pkinase_Tyr 25 280 7.9e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164809
AA Change: N226S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127728
Gene: ENSMUSG00000007591
AA Change: N226S

DomainStartEndE-ValueType
Pfam:Pkinase 25 281 4e-56 PFAM
Pfam:Pkinase_Tyr 25 281 3.3e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226497
AA Change: N222S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000226591
AA Change: N216S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000227297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227568
Predicted Effect probably damaging
Transcript: ENSMUST00000228041
AA Change: N216S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000228395
AA Change: N226S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the testis-specific serine/threonine kinase family. The encoded protein is thought to be involved in spermatogenesis via stimulation of the CREB/CRE responsive pathway through phosphorylation of the cAMP responsive element binding protein transcription factor. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,589,216 H140R possibly damaging Het
Adamts3 A G 5: 89,707,453 probably benign Het
Apob T G 12: 8,010,778 F3054V probably damaging Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Calcb A T 7: 114,719,829 R30W probably damaging Het
Cbl T C 9: 44,151,446 *914W probably null Het
Chd4 A G 6: 125,120,560 probably benign Het
Clec4a2 A T 6: 123,139,411 probably null Het
Crb2 T A 2: 37,792,217 V870E probably benign Het
Cyp2c39 A G 19: 39,536,862 E203G probably damaging Het
Dhrs7 A T 12: 72,664,727 L12Q probably damaging Het
Dnah5 A G 15: 28,295,267 Y1382C probably benign Het
Efs C T 14: 54,920,224 R117Q probably damaging Het
Evl T C 12: 108,648,308 probably benign Het
Fbxo16 T C 14: 65,293,784 F46L probably damaging Het
Fsip2 A G 2: 82,992,010 E6029G possibly damaging Het
Gm20775 A T Y: 10,641,956 noncoding transcript Het
Gm4924 T A 10: 82,379,030 Y887* probably null Het
H60c G T 10: 3,260,382 R56S possibly damaging Het
Hbq1a T G 11: 32,300,715 S133A probably benign Het
Hhipl1 A G 12: 108,311,689 E92G probably damaging Het
Knl1 A T 2: 119,062,362 E46D probably damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mmp21 T C 7: 133,678,750 T164A probably benign Het
Mthfd2 T C 6: 83,311,348 R142G probably benign Het
Mup4 T G 4: 59,959,192 probably null Het
Npas3 A T 12: 54,069,049 Q900L probably damaging Het
Nr1h3 T C 2: 91,191,860 D141G probably damaging Het
Rap2a G T 14: 120,503,758 A158S possibly damaging Het
Rttn A G 18: 89,095,571 T1705A probably benign Het
Ryr3 A T 2: 112,656,531 V3834E probably damaging Het
Taf5 A C 19: 47,075,833 K405T probably damaging Het
Tbc1d19 T C 5: 53,848,206 probably benign Het
Tmem232 A T 17: 65,265,302 probably null Het
Tulp4 C A 17: 6,206,964 S311R probably benign Het
Uggt1 C A 1: 36,210,059 E267* probably null Het
Usp34 T C 11: 23,370,466 I917T possibly damaging Het
Other mutations in Tssk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Tssk4 APN 14 55650553 missense probably damaging 1.00
IGL02943:Tssk4 APN 14 55651566 missense probably damaging 1.00
IGL03082:Tssk4 APN 14 55651061 missense probably damaging 1.00
IGL03281:Tssk4 APN 14 55650428 missense possibly damaging 0.86
R0201:Tssk4 UTSW 14 55651559 nonsense probably null
R0201:Tssk4 UTSW 14 55651560 missense probably damaging 1.00
R1655:Tssk4 UTSW 14 55651695 missense probably damaging 1.00
R1660:Tssk4 UTSW 14 55650572 missense probably null 0.90
R1743:Tssk4 UTSW 14 55651031 missense probably damaging 1.00
R2103:Tssk4 UTSW 14 55651540 missense probably damaging 1.00
R3432:Tssk4 UTSW 14 55651695 missense probably damaging 1.00
R4113:Tssk4 UTSW 14 55650373 missense probably benign 0.00
R4870:Tssk4 UTSW 14 55651815 missense probably benign 0.38
R4957:Tssk4 UTSW 14 55651809 missense probably damaging 1.00
R5147:Tssk4 UTSW 14 55650973 missense possibly damaging 0.56
R6785:Tssk4 UTSW 14 55650475 missense probably damaging 1.00
R6917:Tssk4 UTSW 14 55652407 missense probably benign 0.13
Z1088:Tssk4 UTSW 14 55650923 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAACCTGTTGCTGGACAAG -3'
(R):5'- TGACAAAAGCCAACCCTGGG -3'

Sequencing Primer
(F):5'- CAAGCGGGAGAATGTGAAGATATC -3'
(R):5'- GGAAGGCCTAAATTTGGTATTTCC -3'
Posted On2015-02-18