Incidental Mutation 'R1954:Notch3'
ID268144
Institutional Source Beutler Lab
Gene Symbol Notch3
Ensembl Gene ENSMUSG00000038146
Gene Namenotch 3
SynonymsN3, hpbk
MMRRC Submission 039968-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1954 (G1)
Quality Score51
Status Validated
Chromosome17
Chromosomal Location32120820-32166880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 32166678 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 39 (A39E)
Ref Sequence ENSEMBL: ENSMUSP00000085016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087723]
Predicted Effect probably benign
Transcript: ENSMUST00000087723
AA Change: A39E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000085016
Gene: ENSMUSG00000038146
AA Change: A39E

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
EGF 42 78 3.73e-5 SMART
EGF 82 119 1.78e-2 SMART
EGF 123 157 1.13e-4 SMART
EGF_CA 159 196 1.89e-15 SMART
EGF 201 235 3.85e-7 SMART
EGF_CA 237 273 3.97e-9 SMART
EGF_CA 275 313 4.63e-10 SMART
EGF_CA 315 351 1.05e-8 SMART
EGF 355 390 1.28e-3 SMART
EGF_CA 392 430 6.29e-12 SMART
EGF_CA 432 468 1.11e-12 SMART
EGF_CA 470 506 4.21e-13 SMART
EGF_CA 508 544 8.43e-13 SMART
EGF_CA 546 581 9.54e-12 SMART
EGF_CA 583 619 1.31e-9 SMART
EGF_CA 621 656 2.03e-6 SMART
EGF_CA 658 694 2.28e-9 SMART
EGF 699 731 7.18e-7 SMART
EGF 738 771 2.5e-6 SMART
EGF 775 809 8e-5 SMART
EGF_CA 811 848 4.77e-12 SMART
EGF_CA 850 886 3.81e-11 SMART
EGF_CA 888 923 1.47e-12 SMART
EGF_CA 925 961 3.4e-8 SMART
EGF 966 999 5.74e-6 SMART
EGF 1004 1035 7.18e-7 SMART
EGF 1040 1083 1.21e-4 SMART
EGF_CA 1085 1121 1.29e-8 SMART
EGF_CA 1123 1159 1.45e-11 SMART
EGF_CA 1161 1204 1.26e-11 SMART
EGF 1209 1245 1.53e-1 SMART
EGF 1250 1288 8e-5 SMART
EGF 1293 1326 1.13e1 SMART
EGF 1339 1374 5.36e-6 SMART
NL 1381 1419 1.63e-15 SMART
NL 1422 1460 1.78e-16 SMART
NL 1461 1502 1.75e-15 SMART
NOD 1506 1562 2.98e-24 SMART
NODP 1577 1641 1.34e-26 SMART
transmembrane domain 1644 1666 N/A INTRINSIC
low complexity region 1774 1783 N/A INTRINSIC
ANK 1789 1834 1.48e3 SMART
ANK 1839 1868 1.61e-4 SMART
ANK 1872 1902 1.42e0 SMART
ANK 1906 1935 1.77e-1 SMART
ANK 1939 1968 3.18e-3 SMART
ANK 1972 2001 5.16e-3 SMART
low complexity region 2028 2054 N/A INTRINSIC
low complexity region 2108 2123 N/A INTRINSIC
low complexity region 2169 2193 N/A INTRINSIC
DUF3454 2218 2275 2.81e-20 SMART
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (101/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]
PHENOTYPE: Some, but not all, null alleles cause defects in artery morphology and in T cell development. Progressive emaciation and kyphosis with paraphimosis occurs in an intron 31 splice donor site point mutant. In conjunction with Notch1 deficiency, abnormalities in embryonic development have been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,566,753 probably benign Het
Adamts15 T A 9: 30,910,708 M478L probably benign Het
Akap8l T A 17: 32,336,736 Y123F possibly damaging Het
Anapc4 T G 5: 52,846,625 probably benign Het
Arap3 A G 18: 37,982,002 V987A probably damaging Het
Atp2b4 T A 1: 133,739,992 T105S probably damaging Het
Atp6v0d1 A G 8: 105,565,893 L7P probably damaging Het
Atp6v1b2 T C 8: 69,105,903 V341A possibly damaging Het
Baz2b C A 2: 59,968,743 A346S probably benign Het
Brpf3 G A 17: 28,806,559 S202N probably benign Het
Btnl4 T C 17: 34,472,930 K233E possibly damaging Het
Capn7 A G 14: 31,360,150 T438A probably damaging Het
Cars2 A T 8: 11,550,286 Y68N probably damaging Het
Cbx2 G T 11: 119,028,340 G244W probably damaging Het
Ccr4 A T 9: 114,492,685 V104D probably damaging Het
Cdc5l T C 17: 45,426,516 probably null Het
Cep170 A T 1: 176,756,384 C810S probably benign Het
Clp1 T C 2: 84,724,051 D258G probably damaging Het
Clstn3 T C 6: 124,459,298 E164G possibly damaging Het
Col28a1 T C 6: 7,998,516 E1131G probably damaging Het
Cps1 A G 1: 67,195,196 D914G possibly damaging Het
Ctnnal1 C T 4: 56,817,242 probably benign Het
Cyp2c38 A G 19: 39,404,687 L312P probably damaging Het
Cytip T C 2: 58,148,253 N99D possibly damaging Het
Dennd4a A T 9: 64,852,467 T285S probably benign Het
Dhx8 A G 11: 101,753,279 S842G probably damaging Het
Disp1 A T 1: 183,088,543 M771K probably damaging Het
Dnah17 A G 11: 118,024,731 I4326T probably damaging Het
Efcab7 T C 4: 99,900,690 F345L probably damaging Het
Erc1 G T 6: 119,797,305 Q230K probably damaging Het
Ern1 A T 11: 106,421,974 probably benign Het
Espl1 T C 15: 102,298,388 Y96H probably damaging Het
Fam135a A T 1: 24,029,602 L533I probably damaging Het
Fat2 G A 11: 55,311,084 T388I probably benign Het
Galnt1 T G 18: 24,271,774 probably benign Het
Glmn A G 5: 107,572,377 F212S probably damaging Het
Gm3604 A T 13: 62,369,211 N444K probably damaging Het
Gm5434 A G 12: 36,090,596 probably benign Het
Gm8989 A C 7: 106,329,681 D336E probably damaging Het
H2-M10.3 T C 17: 36,367,498 D145G probably damaging Het
Hic2 T A 16: 17,258,993 L562Q probably damaging Het
Hip1r G T 5: 124,001,844 E1003D probably damaging Het
Hist1h1c T C 13: 23,739,402 V185A unknown Het
Hist1h1d A G 13: 23,555,516 probably benign Het
Hsfy2 C T 1: 56,637,183 C65Y probably benign Het
Inpp1 T C 1: 52,794,629 T103A probably damaging Het
Ints5 T C 19: 8,894,896 V73A probably damaging Het
Iqch A T 9: 63,548,016 D166E probably benign Het
Klhdc3 A T 17: 46,677,975 N96K probably damaging Het
Klk1b8 C T 7: 43,953,848 probably benign Het
Klrb1 T C 6: 128,723,073 probably null Het
Krt71 C A 15: 101,735,466 G446* probably null Het
Lars G A 18: 42,210,050 R1101C probably damaging Het
Lemd3 G T 10: 120,978,940 S129R probably damaging Het
Lrp1b A G 2: 40,858,441 L3015P probably damaging Het
Mdga2 T C 12: 66,486,708 probably benign Het
Mlst8 A T 17: 24,477,221 I178N probably damaging Het
Mon2 A T 10: 123,038,483 I320N probably damaging Het
Morc2b T C 17: 33,137,490 Y436C probably damaging Het
Moxd1 T A 10: 24,279,883 M295K probably benign Het
Mrps5 T A 2: 127,596,897 probably null Het
Mtor C A 4: 148,468,273 S744R probably damaging Het
Myo3a T A 2: 22,241,226 D61E probably damaging Het
Nars C T 18: 64,500,564 R545Q probably damaging Het
Ncoa6 A G 2: 155,406,821 V1521A possibly damaging Het
Ndor1 T C 2: 25,255,293 E20G possibly damaging Het
Nipsnap3b T C 4: 53,017,213 probably benign Het
Olfr1336 G T 7: 6,461,145 W212L probably benign Het
Olfr237-ps1 T C 6: 43,153,977 I224T possibly damaging Het
Olfr345 A G 2: 36,640,215 M59V possibly damaging Het
Otud3 T C 4: 138,898,032 K237R possibly damaging Het
Papola T A 12: 105,828,273 probably null Het
Parl T A 16: 20,302,327 M1L possibly damaging Het
Parp14 G T 16: 35,858,301 N432K probably benign Het
Patz1 T G 11: 3,291,088 S159A probably damaging Het
Prpf6 T G 2: 181,632,077 M338R probably benign Het
Psd3 A G 8: 67,697,075 L343P probably damaging Het
Ptpn23 A T 9: 110,386,325 N1422K probably damaging Het
Rab19 A T 6: 39,384,082 T55S probably benign Het
Sh3yl1 A G 12: 30,922,333 K34E possibly damaging Het
Skint8 T A 4: 111,950,081 F321L possibly damaging Het
Slc25a46 A T 18: 31,600,241 probably null Het
Slc26a3 T C 12: 31,450,816 L184S probably damaging Het
Slc39a10 A T 1: 46,835,174 S323T possibly damaging Het
Sorbs2 G T 8: 45,745,738 R20L probably benign Het
Stk32a A T 18: 43,212,025 D13V probably benign Het
Tab2 T C 10: 7,919,330 T463A probably damaging Het
Tenm2 T A 11: 36,047,547 N1433I possibly damaging Het
Tmem200c A T 17: 68,840,961 I180F probably damaging Het
Tmem232 G T 17: 65,484,487 H129N probably benign Het
Tmem242 T C 17: 5,439,579 T47A possibly damaging Het
Ube2d1 A T 10: 71,285,123 M1K probably null Het
Uckl1 T C 2: 181,570,527 Q332R probably benign Het
Unc5b T C 10: 60,769,265 probably benign Het
Vmn2r114 T C 17: 23,311,112 Y107C probably benign Het
Vmn2r82 A T 10: 79,396,056 S630C probably damaging Het
Wdr25 T A 12: 108,898,541 V204E probably damaging Het
Xab2 T A 8: 3,616,094 D227V probably damaging Het
Zfp286 A G 11: 62,783,708 S104P possibly damaging Het
Zfp345 T C 2: 150,474,821 D22G probably damaging Het
Other mutations in Notch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Notch3 APN 17 32158114 nonsense probably null
IGL01065:Notch3 APN 17 32146416 nonsense probably null
IGL01296:Notch3 APN 17 32166757 missense unknown
IGL01322:Notch3 APN 17 32144471 missense probably damaging 1.00
IGL01343:Notch3 APN 17 32143436 missense probably benign 0.10
IGL01358:Notch3 APN 17 32144747 missense probably damaging 1.00
IGL01600:Notch3 APN 17 32144498 missense probably damaging 1.00
IGL01622:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01623:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01971:Notch3 APN 17 32124347 missense probably damaging 1.00
IGL02000:Notch3 APN 17 32122742 missense probably damaging 0.99
IGL02072:Notch3 APN 17 32147074 nonsense probably null
IGL02145:Notch3 APN 17 32154741 missense probably benign 0.01
IGL02256:Notch3 APN 17 32132324 missense probably damaging 1.00
IGL02366:Notch3 APN 17 32144205 missense probably benign
IGL02476:Notch3 APN 17 32158638 missense possibly damaging 0.67
IGL02502:Notch3 APN 17 32158278 nonsense probably null
IGL02551:Notch3 APN 17 32154731 splice site probably benign
divide UTSW 17 32137813 splice site probably null
lopressor UTSW 17 32153884 missense probably damaging 1.00
PIT4486001:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R0115:Notch3 UTSW 17 32133462 missense possibly damaging 0.82
R0201:Notch3 UTSW 17 32156148 splice site probably benign
R0630:Notch3 UTSW 17 32147472 splice site probably benign
R1167:Notch3 UTSW 17 32122745 missense possibly damaging 0.95
R1432:Notch3 UTSW 17 32164224 missense probably benign
R1567:Notch3 UTSW 17 32158580 missense possibly damaging 0.77
R1623:Notch3 UTSW 17 32139191 missense probably benign 0.00
R1663:Notch3 UTSW 17 32156119 missense probably damaging 1.00
R1668:Notch3 UTSW 17 32158589 missense probably damaging 0.99
R1789:Notch3 UTSW 17 32158725 missense probably damaging 1.00
R1813:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1837:Notch3 UTSW 17 32124322 missense probably damaging 1.00
R1896:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1937:Notch3 UTSW 17 32153852 missense probably benign 0.03
R2014:Notch3 UTSW 17 32158000 missense probably benign 0.00
R2058:Notch3 UTSW 17 32143644 missense probably benign
R2068:Notch3 UTSW 17 32135508 missense probably benign 0.00
R2097:Notch3 UTSW 17 32122754 missense probably damaging 1.00
R2112:Notch3 UTSW 17 32144610 missense probably benign 0.19
R2156:Notch3 UTSW 17 32147844 missense probably damaging 1.00
R2211:Notch3 UTSW 17 32147978 missense probably benign 0.00
R2324:Notch3 UTSW 17 32150134 splice site probably benign
R2432:Notch3 UTSW 17 32153804 missense probably damaging 1.00
R3117:Notch3 UTSW 17 32158115 missense probably damaging 1.00
R3236:Notch3 UTSW 17 32158461 missense probably damaging 0.96
R3409:Notch3 UTSW 17 32150702 missense possibly damaging 0.67
R3434:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3435:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3438:Notch3 UTSW 17 32153590 missense probably damaging 1.00
R3926:Notch3 UTSW 17 32153557 missense possibly damaging 0.92
R4087:Notch3 UTSW 17 32158113 missense possibly damaging 0.60
R4115:Notch3 UTSW 17 32158433 missense probably damaging 1.00
R4214:Notch3 UTSW 17 32132207 missense possibly damaging 0.96
R4234:Notch3 UTSW 17 32141341 missense probably damaging 0.97
R4242:Notch3 UTSW 17 32143745 missense possibly damaging 0.74
R4658:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R4878:Notch3 UTSW 17 32147085 missense probably damaging 1.00
R4879:Notch3 UTSW 17 32147963 missense probably benign 0.00
R4885:Notch3 UTSW 17 32141377 missense probably damaging 0.98
R4924:Notch3 UTSW 17 32144731 missense probably damaging 1.00
R5084:Notch3 UTSW 17 32157890 critical splice donor site probably null
R5086:Notch3 UTSW 17 32143334 missense probably benign 0.13
R5343:Notch3 UTSW 17 32143283 missense probably benign 0.03
R5389:Notch3 UTSW 17 32139189 missense probably benign
R5503:Notch3 UTSW 17 32147055 missense probably benign 0.00
R5698:Notch3 UTSW 17 32157987 missense probably damaging 1.00
R5824:Notch3 UTSW 17 32153861 missense possibly damaging 0.92
R5969:Notch3 UTSW 17 32153884 missense probably damaging 1.00
R6050:Notch3 UTSW 17 32143527 missense probably benign
R6274:Notch3 UTSW 17 32147290 missense probably benign
R6276:Notch3 UTSW 17 32154749 missense probably benign 0.10
R6313:Notch3 UTSW 17 32151154 intron probably null
R6316:Notch3 UTSW 17 32137813 splice site probably null
R6380:Notch3 UTSW 17 32144559 missense probably damaging 1.00
R6401:Notch3 UTSW 17 32158623 missense probably benign 0.01
R6502:Notch3 UTSW 17 32158217 missense probably damaging 1.00
R6741:Notch3 UTSW 17 32143484 missense probably benign 0.16
R7131:Notch3 UTSW 17 32144217 missense probably benign
R7140:Notch3 UTSW 17 32156377 missense possibly damaging 0.84
R7162:Notch3 UTSW 17 32146449 missense probably damaging 0.98
R7171:Notch3 UTSW 17 32158962 missense probably damaging 1.00
R7449:Notch3 UTSW 17 32157966 missense probably damaging 1.00
R7450:Notch3 UTSW 17 32141391 missense possibly damaging 0.69
R7554:Notch3 UTSW 17 32122371 missense probably benign 0.03
T0975:Notch3 UTSW 17 32146417 missense probably damaging 0.99
Z1088:Notch3 UTSW 17 32158652 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCGAACCCCATGACTGATAC -3'
(R):5'- TGAGTGTACCGAGGTCTGCAAG -3'

Sequencing Primer
(F):5'- GACTGATACACACCCCCAGCTG -3'
(R):5'- TCTGCAAGTCCCAGGCTTG -3'
Posted On2015-02-19