Mutagenetix > Incidental Mutation

Incidental Mutation 'R3545:Nid2'

268180

Institutional Source

Beutler Lab

Gene Symbol

Nid2

Ensembl Gene

ENSMUSG00000021806

Gene Name

nidogen 2

Synonyms

entactin 2, entactin-2

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.162) question?

Stock #

R3545 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

19801333-19861855 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 19813779 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 195 (Y195N)

Ref Sequence

ENSEMBL: ENSMUSP00000022340 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022340]

AlphaFold

O88322

Predicted Effect

probably damaging
Transcript: ENSMUST00000022340
AA Change: Y195N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022340
Gene: ENSMUSG00000021806
AA Change: Y195N

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Blast:NIDO	39	77	3e-11	BLAST
NIDO	108	276	1.12e-72	SMART
low complexity region	421	430	N/A	INTRINSIC
low complexity region	452	470	N/A	INTRINSIC
EGF	510	547	1.84e1	SMART
G2F	548	780	4.36e-143	SMART
EGF	785	823	2.52e-2	SMART
EGF_CA	824	866	1.45e-11	SMART
EGF	874	914	3.15e-3	SMART
EGF_CA	915	953	5.03e-11	SMART
TY	988	1037	8.27e-20	SMART
TY	1068	1116	1.19e-20	SMART
LY	1162	1204	1.15e-5	SMART
LY	1206	1248	8.82e-16	SMART
LY	1249	1293	1.51e-14	SMART
LY	1294	1336	3.56e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000224263

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225791

Meta Mutation Damage Score

0.8482

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nidogen family of basement membrane proteins. This protein is a cell-adhesion protein that binds collagens I and IV and laminin and may be involved in maintaining the structure of the basement membrane.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a null alleleexhibit calcification of joint cartilage and osteoarthritis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd28	A	G	14: 31,437,217 (GRCm39)	L646S	probably benign	Het
Clip1	A	G	5: 123,769,141 (GRCm39)	L532P	probably damaging	Het
Efl1	A	T	7: 82,412,018 (GRCm39)	E802D	probably benign	Het
F11r	T	C	1: 171,288,829 (GRCm39)	V149A	probably damaging	Het
Fhit	T	C	14: 9,870,095 (GRCm38)	T125A	probably benign	Het
Fmn2	A	G	1: 174,330,192 (GRCm39)	D194G	unknown	Het
Gdi1	T	A	X: 73,351,414 (GRCm39)	F175L	possibly damaging	Het
Herc3	T	C	6: 58,833,670 (GRCm39)	S186P	probably damaging	Het
Hexa	A	G	9: 59,464,581 (GRCm39)	N157S	probably damaging	Het
Kdm1b	C	T	13: 47,216,553 (GRCm39)	R308W	probably damaging	Het
Lig1	T	A	7: 13,026,089 (GRCm39)	N281K	possibly damaging	Het
Lrp1b	A	T	2: 40,490,300 (GRCm39)	L287H	probably damaging	Het
Mcf2	T	C	X: 59,180,806 (GRCm39)	K74R	probably damaging	Het
Nat1	A	G	8: 67,943,684 (GRCm39)	D23G	possibly damaging	Het
Nbeal1	T	C	1: 60,317,939 (GRCm39)	F1959L	probably damaging	Het
Ncf1	T	A	5: 134,255,463 (GRCm39)	K143*	probably null	Het
Nlrp9a	T	C	7: 26,256,757 (GRCm39)	I125T	probably benign	Het
Nme7	T	C	1: 164,213,351 (GRCm39)	F343S	probably damaging	Het
Otud4	A	G	8: 80,391,684 (GRCm39)	E443G	probably damaging	Het
Palld	G	T	8: 62,003,112 (GRCm39)	A329E	possibly damaging	Het
Pask	A	T	1: 93,244,837 (GRCm39)	V1095D	probably damaging	Het
Pdzd2	C	T	15: 12,375,557 (GRCm39)	R1526Q	probably benign	Het
Prkcq	A	G	2: 11,288,627 (GRCm39)	K527E	probably benign	Het
Ramac	T	A	7: 81,418,270 (GRCm39)		probably null	Het
Reln	A	G	5: 22,432,598 (GRCm39)	V134A	possibly damaging	Het
Rufy4	T	C	1: 74,186,822 (GRCm39)	C537R	probably damaging	Het
Septin9	T	C	11: 117,243,499 (GRCm39)	I350T	probably damaging	Het
Slc16a7	T	A	10: 125,130,569 (GRCm39)	K39*	probably null	Het
Spata32	T	C	11: 103,101,570 (GRCm39)	E21G	possibly damaging	Het
Tbc1d1	G	A	5: 64,443,350 (GRCm39)	R523Q	probably damaging	Het
Thnsl1	T	G	2: 21,217,438 (GRCm39)	D397E	probably benign	Het
Tubal3	T	G	13: 3,983,560 (GRCm39)	*447G	probably null	Het
Uprt	T	A	X: 103,526,934 (GRCm39)	L123H	probably damaging	Het
Usp9x	T	C	X: 12,994,629 (GRCm39)	L940P	probably benign	Het

Other mutations in Nid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01783:Nid2	APN	14	19,818,745 (GRCm39)	missense	probably benign
IGL01788:Nid2	APN	14	19,858,047 (GRCm39)	missense	probably damaging	1.00
IGL02259:Nid2	APN	14	19,818,277 (GRCm39)	critical splice acceptor site	probably null
IGL03084:Nid2	APN	14	19,819,000 (GRCm39)	missense	probably benign	0.05
IGL03247:Nid2	APN	14	19,829,688 (GRCm39)	missense	probably damaging	1.00
IGL03098:Nid2	UTSW	14	19,856,006 (GRCm39)	missense	probably damaging	0.99
PIT4810001:Nid2	UTSW	14	19,860,158 (GRCm39)	missense	possibly damaging	0.82
R0173:Nid2	UTSW	14	19,852,400 (GRCm39)	splice site	probably benign
R0501:Nid2	UTSW	14	19,839,736 (GRCm39)	splice site	probably null
R1117:Nid2	UTSW	14	19,813,732 (GRCm39)	critical splice acceptor site	probably null
R1305:Nid2	UTSW	14	19,818,930 (GRCm39)	missense	probably benign	0.00
R1572:Nid2	UTSW	14	19,855,480 (GRCm39)	missense	probably benign	0.08
R1594:Nid2	UTSW	14	19,831,329 (GRCm39)	missense	probably benign	0.03
R1789:Nid2	UTSW	14	19,802,499 (GRCm39)	missense	possibly damaging	0.95
R1927:Nid2	UTSW	14	19,818,344 (GRCm39)	missense	probably damaging	1.00
R2085:Nid2	UTSW	14	19,828,111 (GRCm39)	missense	probably benign	0.12
R2086:Nid2	UTSW	14	19,828,111 (GRCm39)	missense	probably benign	0.12
R2100:Nid2	UTSW	14	19,828,946 (GRCm39)	nonsense	probably null
R2158:Nid2	UTSW	14	19,828,111 (GRCm39)	missense	probably benign	0.12
R2240:Nid2	UTSW	14	19,855,982 (GRCm39)	missense	probably damaging	0.99
R2314:Nid2	UTSW	14	19,839,829 (GRCm39)	missense	probably benign	0.01
R2863:Nid2	UTSW	14	19,818,471 (GRCm39)	missense	possibly damaging	0.92
R3113:Nid2	UTSW	14	19,828,111 (GRCm39)	missense	probably benign	0.12
R3548:Nid2	UTSW	14	19,813,779 (GRCm39)	missense	probably damaging	1.00
R3801:Nid2	UTSW	14	19,860,065 (GRCm39)	missense	probably damaging	1.00
R4618:Nid2	UTSW	14	19,858,078 (GRCm39)	missense	probably damaging	0.99
R4798:Nid2	UTSW	14	19,839,829 (GRCm39)	missense	probably benign	0.01
R4953:Nid2	UTSW	14	19,828,146 (GRCm39)	nonsense	probably null
R5256:Nid2	UTSW	14	19,818,276 (GRCm39)	critical splice acceptor site	probably null
R5289:Nid2	UTSW	14	19,855,379 (GRCm39)	missense	possibly damaging	0.95
R5302:Nid2	UTSW	14	19,829,769 (GRCm39)	missense	probably benign
R5409:Nid2	UTSW	14	19,856,030 (GRCm39)	missense	probably damaging	1.00
R5514:Nid2	UTSW	14	19,852,535 (GRCm39)	missense	probably damaging	1.00
R6134:Nid2	UTSW	14	19,828,851 (GRCm39)	missense	probably damaging	1.00
R6365:Nid2	UTSW	14	19,853,201 (GRCm39)	missense	probably damaging	1.00
R6647:Nid2	UTSW	14	19,852,484 (GRCm39)	missense	probably benign	0.04
R6758:Nid2	UTSW	14	19,852,551 (GRCm39)	missense	probably damaging	1.00
R6882:Nid2	UTSW	14	19,839,775 (GRCm39)	missense	probably damaging	1.00
R6893:Nid2	UTSW	14	19,839,855 (GRCm39)	missense	probably benign	0.34
R7045:Nid2	UTSW	14	19,829,749 (GRCm39)	missense	possibly damaging	0.94
R7392:Nid2	UTSW	14	19,818,724 (GRCm39)	missense	probably benign	0.00
R7477:Nid2	UTSW	14	19,856,041 (GRCm39)	missense	probably benign	0.09
R7515:Nid2	UTSW	14	19,841,635 (GRCm39)	missense	probably benign	0.06
R7547:Nid2	UTSW	14	19,847,345 (GRCm39)	missense	probably benign
R7594:Nid2	UTSW	14	19,818,791 (GRCm39)	missense	probably benign	0.00
R7615:Nid2	UTSW	14	19,852,598 (GRCm39)	missense	probably damaging	1.00
R7680:Nid2	UTSW	14	19,829,715 (GRCm39)	missense	probably damaging	1.00
R8097:Nid2	UTSW	14	19,848,657 (GRCm39)	missense	possibly damaging	0.77
R8167:Nid2	UTSW	14	19,860,131 (GRCm39)	missense	possibly damaging	0.57
R8292:Nid2	UTSW	14	19,818,346 (GRCm39)	missense	probably damaging	0.99
R8766:Nid2	UTSW	14	19,802,340 (GRCm39)	missense	probably benign	0.26
R9093:Nid2	UTSW	14	19,858,009 (GRCm39)	missense
R9193:Nid2	UTSW	14	19,853,278 (GRCm39)	missense	probably damaging	1.00
RF002:Nid2	UTSW	14	19,801,434 (GRCm39)	small deletion	probably benign
RF016:Nid2	UTSW	14	19,801,431 (GRCm39)	small deletion	probably benign
X0009:Nid2	UTSW	14	19,852,579 (GRCm39)	missense	probably damaging	1.00
X0021:Nid2	UTSW	14	19,818,930 (GRCm39)	missense	probably benign	0.00
X0026:Nid2	UTSW	14	19,828,199 (GRCm39)	missense	probably damaging	0.96
Z1177:Nid2	UTSW	14	19,839,876 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGTTCAAAACCAATGTGGGG -3'
(R):5'- TCCTAAATGTCATTCCAGTGGGTAAC -3'

Sequencing Primer
(F):5'- GTTCAAAACCAATGTGGGGAATTCC -3'
(R):5'- AGAGATTCTTCACAGACTGCTCGG -3'

Posted On

2015-02-19