Mutagenetix > Incidental Mutation

Incidental Mutation 'R3545:Gdi1'

268185

Institutional Source

Beutler Lab

Gene Symbol

Gdi1

Ensembl Gene

ENSMUSG00000015291

Gene Name

GDP dissociation inhibitor 1

Synonyms

GDIA, Rab GDIalpha

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.324) question?

Stock #

R3545 (G1)

Quality Score

222

Status

Not validated

Chromosome

Chromosomal Location

73348618-73355473 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 73351414 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 175 (F175L)

Ref Sequence

ENSEMBL: ENSMUSP00000015435 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015435] [ENSMUST00000019231] [ENSMUST00000114171] [ENSMUST00000124797] [ENSMUST00000130581] [ENSMUST00000147275] [ENSMUST00000153141]

AlphaFold

P50396

Predicted Effect

possibly damaging
Transcript: ENSMUST00000015435
AA Change: F175L

PolyPhen 2 Score 0.591 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000015435
Gene: ENSMUSG00000015291
AA Change: F175L

Domain	Start	End	E-Value	Type
Pfam:GDI	1	436	5.6e-245	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000019231

SMART Domains

Protein: ENSMUSP00000019231
Gene: ENSMUSG00000019087

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
low complexity region	161	175	N/A	INTRINSIC
transmembrane domain	419	441	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114171

SMART Domains

Protein: ENSMUSP00000109808
Gene: ENSMUSG00000019087

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:ATP-synt_S1	38	405	1.1e-72	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124797

SMART Domains

Protein: ENSMUSP00000118722
Gene: ENSMUSG00000019087

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Pfam:ATP-synt_S1	20	100	2.9e-25	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128915

Predicted Effect

probably benign
Transcript: ENSMUST00000130581

SMART Domains

Protein: ENSMUSP00000122146
Gene: ENSMUSG00000015291

Domain	Start	End	E-Value	Type
Pfam:GDI	1	63	1.4e-29	PFAM
Pfam:GDI	61	140	6.2e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135041

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144317

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146013

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149391

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144075

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144506

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137447

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145580

Predicted Effect

probably benign
Transcript: ENSMUST00000147275

SMART Domains

Protein: ENSMUSP00000116162
Gene: ENSMUSG00000019087

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:ATP-synt_S1	38	157	3.2e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000154630

Predicted Effect

probably benign
Transcript: ENSMUST00000153141

SMART Domains

Protein: ENSMUSP00000119805
Gene: ENSMUSG00000015291

Domain	Start	End	E-Value	Type
Pfam:GDI	1	78	1.6e-37	PFAM

Meta Mutation Damage Score

0.9060

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GDP dissociation inhibitors are proteins that regulate the GDP-GTP exchange reaction of members of the rab family, small GTP-binding proteins of the ras superfamily, that are involved in vesicular trafficking of molecules between cellular organelles. GDIs slow the rate of dissociation of GDP from rab proteins and release GDP from membrane-bound rabs. GDI1 is expressed primarily in neural and sensory tissues. Mutations in GDI1 have been linked to X-linked nonspecific mental retardation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Males hemizygous for a reporter allele show lower male aggression, short-term memory defects, altered synaptic vesicle pools and short-term synaptic plasticity, and impaired glutamate release. Homozygotes for a null allele show enhanced paired-pulse facilitation and sensitivity to induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd28	A	G	14: 31,437,217 (GRCm39)	L646S	probably benign	Het
Clip1	A	G	5: 123,769,141 (GRCm39)	L532P	probably damaging	Het
Efl1	A	T	7: 82,412,018 (GRCm39)	E802D	probably benign	Het
F11r	T	C	1: 171,288,829 (GRCm39)	V149A	probably damaging	Het
Fhit	T	C	14: 9,870,095 (GRCm38)	T125A	probably benign	Het
Fmn2	A	G	1: 174,330,192 (GRCm39)	D194G	unknown	Het
Herc3	T	C	6: 58,833,670 (GRCm39)	S186P	probably damaging	Het
Hexa	A	G	9: 59,464,581 (GRCm39)	N157S	probably damaging	Het
Kdm1b	C	T	13: 47,216,553 (GRCm39)	R308W	probably damaging	Het
Lig1	T	A	7: 13,026,089 (GRCm39)	N281K	possibly damaging	Het
Lrp1b	A	T	2: 40,490,300 (GRCm39)	L287H	probably damaging	Het
Mcf2	T	C	X: 59,180,806 (GRCm39)	K74R	probably damaging	Het
Nat1	A	G	8: 67,943,684 (GRCm39)	D23G	possibly damaging	Het
Nbeal1	T	C	1: 60,317,939 (GRCm39)	F1959L	probably damaging	Het
Ncf1	T	A	5: 134,255,463 (GRCm39)	K143*	probably null	Het
Nid2	T	A	14: 19,813,779 (GRCm39)	Y195N	probably damaging	Het
Nlrp9a	T	C	7: 26,256,757 (GRCm39)	I125T	probably benign	Het
Nme7	T	C	1: 164,213,351 (GRCm39)	F343S	probably damaging	Het
Otud4	A	G	8: 80,391,684 (GRCm39)	E443G	probably damaging	Het
Palld	G	T	8: 62,003,112 (GRCm39)	A329E	possibly damaging	Het
Pask	A	T	1: 93,244,837 (GRCm39)	V1095D	probably damaging	Het
Pdzd2	C	T	15: 12,375,557 (GRCm39)	R1526Q	probably benign	Het
Prkcq	A	G	2: 11,288,627 (GRCm39)	K527E	probably benign	Het
Ramac	T	A	7: 81,418,270 (GRCm39)		probably null	Het
Reln	A	G	5: 22,432,598 (GRCm39)	V134A	possibly damaging	Het
Rufy4	T	C	1: 74,186,822 (GRCm39)	C537R	probably damaging	Het
Septin9	T	C	11: 117,243,499 (GRCm39)	I350T	probably damaging	Het
Slc16a7	T	A	10: 125,130,569 (GRCm39)	K39*	probably null	Het
Spata32	T	C	11: 103,101,570 (GRCm39)	E21G	possibly damaging	Het
Tbc1d1	G	A	5: 64,443,350 (GRCm39)	R523Q	probably damaging	Het
Thnsl1	T	G	2: 21,217,438 (GRCm39)	D397E	probably benign	Het
Tubal3	T	G	13: 3,983,560 (GRCm39)	*447G	probably null	Het
Uprt	T	A	X: 103,526,934 (GRCm39)	L123H	probably damaging	Het
Usp9x	T	C	X: 12,994,629 (GRCm39)	L940P	probably benign	Het

Other mutations in Gdi1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02965:Gdi1	APN	X	73,351,331 (GRCm39)	missense	probably benign
R3547:Gdi1	UTSW	X	73,351,414 (GRCm39)	missense	possibly damaging	0.59
R7097:Gdi1	UTSW	X	73,350,461 (GRCm39)	missense	probably benign	0.00
R7098:Gdi1	UTSW	X	73,350,461 (GRCm39)	missense	probably benign	0.00
R7099:Gdi1	UTSW	X	73,350,461 (GRCm39)	missense	probably benign	0.00
R7163:Gdi1	UTSW	X	73,350,461 (GRCm39)	missense	probably benign	0.00
R7212:Gdi1	UTSW	X	73,350,461 (GRCm39)	missense	probably benign	0.00
R7340:Gdi1	UTSW	X	73,350,461 (GRCm39)	missense	probably benign	0.00
R7341:Gdi1	UTSW	X	73,350,461 (GRCm39)	missense	probably benign	0.00
R7557:Gdi1	UTSW	X	73,350,461 (GRCm39)	missense	probably benign	0.00
R7558:Gdi1	UTSW	X	73,350,461 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AACCAGCTTTCTTGGCCTGC -3'
(R):5'- TCTGGAGCTGAGCACAAGAG -3'

Sequencing Primer
(F):5'- CTATGTCCCAGTAATGCTAAGGGTC -3'
(R):5'- GCTGAGCACAAGAGACATGC -3'

Posted On

2015-02-19