Incidental Mutation 'R3546:Ceacam1'
ID268200
Institutional Source Beutler Lab
Gene Symbol Ceacam1
Ensembl Gene ENSMUSG00000074272
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 1
SynonymsCea1, C-CAM, Cc1, Hv2, CD66a, Cea-7, Cea7, Mhv-1, Hv-2, MHVR1, mmCGM1, mCEA1, Bgp1, mmCGM2, Bgp, Cea-1
MMRRC Submission 040665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R3546 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25461707-25477603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25471914 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 375 (N375S)
Ref Sequence ENSEMBL: ENSMUSP00000145590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098666] [ENSMUST00000098668] [ENSMUST00000098669] [ENSMUST00000205308] [ENSMUST00000206171] [ENSMUST00000206583] [ENSMUST00000206676] [ENSMUST00000206687]
Predicted Effect probably benign
Transcript: ENSMUST00000098666
AA Change: N375S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096263
Gene: ENSMUSG00000074272
AA Change: N375S

DomainStartEndE-ValueType
Pfam:V-set 18 140 1e-21 PFAM
IGc2 158 224 1.61e-7 SMART
IGc2 252 308 5.04e-9 SMART
IGc2 337 401 8.37e-15 SMART
transmembrane domain 426 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098668
AA Change: N195S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000096265
Gene: ENSMUSG00000074272
AA Change: N195S

DomainStartEndE-ValueType
Pfam:V-set 12 140 2.4e-21 PFAM
IGc2 157 221 8.37e-15 SMART
transmembrane domain 246 268 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098669
AA Change: N375S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000096266
Gene: ENSMUSG00000074272
AA Change: N375S

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:V-set 39 141 3.6e-13 PFAM
IGc2 158 224 1.61e-7 SMART
IGc2 252 308 5.04e-9 SMART
IGc2 337 401 8.37e-15 SMART
transmembrane domain 426 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205308
AA Change: N195S

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000206171
AA Change: N375S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206483
Predicted Effect probably benign
Transcript: ENSMUST00000206583
Predicted Effect probably benign
Transcript: ENSMUST00000206676
AA Change: N375S

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000206687
AA Change: N195S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206981
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (31/31)
MGI Phenotype PHENOTYPE: Mice lacking appreciable levels of the two isoforms containing 4 Ig domains and having increased levels of the two isoforms containing 2 Ig domains are viable and fertile. They are significantly more resistant to mouse hepatitis virus than wild-type mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,693,136 probably benign Het
AA986860 A G 1: 130,741,189 probably benign Het
Bves A G 10: 45,354,811 R293G probably damaging Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Cyth1 A G 11: 118,192,436 V46A probably damaging Het
Ddx23 G A 15: 98,650,732 T365M probably damaging Het
Etaa1 A G 11: 17,953,823 probably benign Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Hdac7 G T 15: 97,808,009 Q361K probably damaging Het
Itk A G 11: 46,355,848 L181P probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Mei1 A G 15: 82,098,042 Y677C probably damaging Het
Mslnl T C 17: 25,744,969 V424A probably damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr524 A G 7: 140,202,101 I223T probably damaging Het
Pdilt C A 7: 119,500,488 E186* probably null Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Sult6b1 G A 17: 78,906,907 T29I probably benign Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ush1g T A 11: 115,318,897 H157L probably damaging Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Other mutations in Ceacam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00701:Ceacam1 APN 7 25471914 missense possibly damaging 0.86
IGL01766:Ceacam1 APN 7 25471995 missense probably damaging 1.00
IGL02094:Ceacam1 APN 7 25474543 missense probably damaging 1.00
IGL02869:Ceacam1 APN 7 25476541 missense probably benign 0.07
IGL03325:Ceacam1 APN 7 25476487 missense possibly damaging 0.83
R0464:Ceacam1 UTSW 7 25472017 missense possibly damaging 0.64
R1270:Ceacam1 UTSW 7 25466314 splice site probably null
R1771:Ceacam1 UTSW 7 25472044 missense probably benign 0.17
R1819:Ceacam1 UTSW 7 25463860 missense possibly damaging 0.68
R1964:Ceacam1 UTSW 7 25474708 missense probably benign 0.13
R2048:Ceacam1 UTSW 7 25476688 missense probably benign 0.09
R2760:Ceacam1 UTSW 7 25477474 missense probably damaging 0.99
R2857:Ceacam1 UTSW 7 25474017 missense probably damaging 0.96
R2859:Ceacam1 UTSW 7 25474017 missense probably damaging 0.96
R4471:Ceacam1 UTSW 7 25474600 missense possibly damaging 0.93
R4606:Ceacam1 UTSW 7 25474526 missense probably damaging 0.97
R4810:Ceacam1 UTSW 7 25474520 makesense probably null
R5291:Ceacam1 UTSW 7 25471831 missense probably damaging 0.99
R5405:Ceacam1 UTSW 7 25463865 missense probably benign 0.41
R5423:Ceacam1 UTSW 7 25474526 missense probably benign 0.01
R5851:Ceacam1 UTSW 7 25474600 missense possibly damaging 0.70
R5967:Ceacam1 UTSW 7 25474742 missense probably damaging 0.97
R6216:Ceacam1 UTSW 7 25471996 missense probably benign 0.19
R6235:Ceacam1 UTSW 7 25471792 splice site probably null
R6323:Ceacam1 UTSW 7 25474651 missense probably damaging 1.00
R6545:Ceacam1 UTSW 7 25473854 missense probably damaging 1.00
X0028:Ceacam1 UTSW 7 25476420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATAAATTGCACCCACCGTC -3'
(R):5'- ACCGTTTCATTCTGTGGGC -3'

Sequencing Primer
(F):5'- CCGTCAACACTCTGTAATAAGAAGGG -3'
(R):5'- TCTCTAAGGATGAAGGACTCTCAGC -3'
Posted On2015-02-19