Incidental Mutation 'R3546:Mslnl'
ID268215
Institutional Source Beutler Lab
Gene Symbol Mslnl
Ensembl Gene ENSMUSG00000041062
Gene Namemesothelin-like
Synonyms
MMRRC Submission 040665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.036) question?
Stock #R3546 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25736040-25748330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25744969 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 424 (V424A)
Ref Sequence ENSEMBL: ENSMUSP00000049020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047098] [ENSMUST00000075884]
Predicted Effect probably damaging
Transcript: ENSMUST00000047098
AA Change: V424A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049020
Gene: ENSMUSG00000041062
AA Change: V424A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Mesothelin 29 589 2.8e-70 PFAM
low complexity region 633 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075884
SMART Domains Protein: ENSMUSP00000075279
Gene: ENSMUSG00000063011

DomainStartEndE-ValueType
Pfam:Mesothelin 1 624 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102319
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,693,136 probably benign Het
AA986860 A G 1: 130,741,189 probably benign Het
Bves A G 10: 45,354,811 R293G probably damaging Het
Ceacam1 T C 7: 25,471,914 N375S probably benign Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Cyth1 A G 11: 118,192,436 V46A probably damaging Het
Ddx23 G A 15: 98,650,732 T365M probably damaging Het
Etaa1 A G 11: 17,953,823 probably benign Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Hdac7 G T 15: 97,808,009 Q361K probably damaging Het
Itk A G 11: 46,355,848 L181P probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Mei1 A G 15: 82,098,042 Y677C probably damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr524 A G 7: 140,202,101 I223T probably damaging Het
Pdilt C A 7: 119,500,488 E186* probably null Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Sult6b1 G A 17: 78,906,907 T29I probably benign Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ush1g T A 11: 115,318,897 H157L probably damaging Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Other mutations in Mslnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Mslnl APN 17 25743667 unclassified probably benign
IGL01629:Mslnl APN 17 25744775 missense possibly damaging 0.95
IGL02084:Mslnl APN 17 25746151 missense probably benign 0.07
IGL02408:Mslnl APN 17 25747998 missense possibly damaging 0.80
IGL02726:Mslnl APN 17 25744103 critical splice donor site probably null
IGL03387:Mslnl APN 17 25744077 missense probably benign 0.06
R0561:Mslnl UTSW 17 25743203 nonsense probably null
R0881:Mslnl UTSW 17 25742965 missense possibly damaging 0.82
R1295:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1296:Mslnl UTSW 17 25743240 missense probably damaging 1.00
R1582:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1629:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1630:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1631:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1632:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1794:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1850:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1866:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1876:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R1914:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2166:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2241:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2243:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2247:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2282:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2284:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2852:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2867:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2877:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2878:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2919:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R2920:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3026:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3405:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3406:Mslnl UTSW 17 25746181 missense probably damaging 1.00
R3411:Mslnl UTSW 17 25744517 missense probably benign 0.05
R3434:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3612:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3729:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3730:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3802:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3804:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3894:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R3895:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4454:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4455:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4456:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4457:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4561:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4562:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4564:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4600:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4601:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4610:Mslnl UTSW 17 25742934 missense probably damaging 0.97
R4704:Mslnl UTSW 17 25738978 missense possibly damaging 0.73
R5155:Mslnl UTSW 17 25738968 nonsense probably null
R5257:Mslnl UTSW 17 25746165 missense probably benign 0.00
R5456:Mslnl UTSW 17 25743159 missense probably damaging 0.98
R5645:Mslnl UTSW 17 25737842 missense possibly damaging 0.95
R6007:Mslnl UTSW 17 25746775 missense probably benign 0.00
R6083:Mslnl UTSW 17 25737902 missense possibly damaging 0.83
R6142:Mslnl UTSW 17 25744557 missense probably damaging 1.00
R6761:Mslnl UTSW 17 25746073 missense probably damaging 1.00
R7058:Mslnl UTSW 17 25743212 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCAGTGGAACATCACATCCG -3'
(R):5'- ATGGCGATCCACTAGACCTCTG -3'

Sequencing Primer
(F):5'- CATCCGGGGACACAGTGATGATC -3'
(R):5'- ACTAGACCTCTGGTGGCGAG -3'
Posted On2015-02-19