Incidental Mutation 'R3547:Prkcq'
ID268221
Institutional Source Beutler Lab
Gene Symbol Prkcq
Ensembl Gene ENSMUSG00000026778
Gene Nameprotein kinase C, theta
SynonymsPKC theta, PKC-0, PKCtheta, PKC-theta, A130035A12Rik, Pkcq
MMRRC Submission 040666-MU
Accession Numbers

Genbank: NM_008859; MGI: 97601

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3547 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location11172108-11301222 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11283816 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 527 (K527E)
Ref Sequence ENSEMBL: ENSMUSP00000100035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028118] [ENSMUST00000102970]
Predicted Effect probably benign
Transcript: ENSMUST00000028118
AA Change: K527E

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000028118
Gene: ENSMUSG00000026778
AA Change: K527E

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 6e-83 PDB
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
S_TKc 380 634 1.17e-97 SMART
S_TK_X 635 698 2.6e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102970
AA Change: K527E

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000100035
Gene: ENSMUSG00000026778
AA Change: K527E

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 2e-84 PDB
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
Pfam:Pkinase_Tyr 380 558 2.8e-27 PFAM
Pfam:Pkinase 380 560 2.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195628
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipid-dependent protein kinase. This kinase is important for T-cell activation. It is required for the activation of the transcription factors NF-kappaB and AP-1, and may link the T cell receptor (TCR) signaling complex to the activation of the transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced T cell proliferative responses and interleukin 2 production and a lack of T cell receptor-initiated NF-kappaB activation in mature T lymphocytes. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Targeted, other(1)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109I03Rik C A 15: 74,881,614 A18S probably null Het
Alg5 A G 3: 54,749,315 R316G probably benign Het
Anapc1 T C 2: 128,642,682 N1121D possibly damaging Het
Antxr2 A T 5: 97,977,657 I247N probably benign Het
Arid5b C T 10: 68,098,462 G294S probably benign Het
Arl9 A G 5: 77,010,479 D136G probably benign Het
Atxn1l A G 8: 109,732,349 L427P possibly damaging Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Clec4a3 A G 6: 122,964,280 E78G probably damaging Het
Clip1 A G 5: 123,631,078 L532P probably damaging Het
Col12a1 T G 9: 79,633,416 K2429T probably damaging Het
Col20a1 G T 2: 180,994,911 E228D probably damaging Het
Cx3cl1 A C 8: 94,778,124 E56A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Fhit T C 14: 9,870,095 T125A probably benign Het
Gdi1 T A X: 74,307,808 F175L possibly damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Gpr149 A T 3: 62,595,128 C436S probably benign Het
Grid2 T C 6: 64,320,021 V456A probably damaging Het
Gstcd G T 3: 133,084,838 T56K possibly damaging Het
Hydin G A 8: 110,582,067 G3995D possibly damaging Het
Igkv4-50 G A 6: 69,700,781 T113I probably benign Het
Igkv5-45 A G 6: 69,776,256 probably benign Het
Igsf10 G A 3: 59,330,541 H740Y probably benign Het
Igsf10 C A 3: 59,336,514 R133L probably damaging Het
Lcmt1 A G 7: 123,400,479 E94G probably benign Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Map3k3 C T 11: 106,142,553 Q211* probably null Het
Map4 T A 9: 110,052,198 F43L possibly damaging Het
Mcf2 T C X: 60,135,446 K74R probably damaging Het
Mylk G A 16: 34,880,168 V460I possibly damaging Het
Nat1 A G 8: 67,491,032 D23G possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Ncf1 T A 5: 134,226,609 K143* probably null Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr549 A G 7: 102,554,470 Y62C probably damaging Het
Pi4k2a C T 19: 42,090,548 P16L probably benign Het
Pitx3 T A 19: 46,136,109 Q273L possibly damaging Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Prickle2 T C 6: 92,411,137 Y428C probably damaging Het
Prune2 T A 19: 17,124,348 S2405R probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rnf167 T C 11: 70,649,681 I129T possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfxn2 T C 19: 46,590,196 S217P probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Slc22a17 A G 14: 54,907,237 L573P probably damaging Het
Slc25a45 T C 19: 5,884,546 Y181H probably damaging Het
Slc6a20a A G 9: 123,660,502 S159P probably damaging Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Thnsl1 T G 2: 21,212,627 D397E probably benign Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ube4b T C 4: 149,335,116 D1045G probably damaging Het
Ugt8a A T 3: 125,867,382 L487* probably null Het
Uprt T A X: 104,483,328 L123H probably damaging Het
Usp9x T C X: 13,128,390 L940P probably benign Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Uty A C Y: 1,158,512 D463E possibly damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Vps13d T G 4: 145,074,975 T3558P probably damaging Het
Zfp319 A G 8: 95,328,817 S253P probably damaging Het
Zfp831 A G 2: 174,657,683 S1265G probably benign Het
Other mutations in Prkcq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:Prkcq APN 2 11283843 missense probably damaging 1.00
IGL01656:Prkcq APN 2 11226955 missense probably damaging 1.00
IGL01732:Prkcq APN 2 11260833 splice site probably benign
IGL02136:Prkcq APN 2 11260668 missense probably benign 0.00
IGL02161:Prkcq APN 2 11277076 missense probably benign
IGL02178:Prkcq APN 2 11277040 missense possibly damaging 0.93
IGL03107:Prkcq APN 2 11260786 missense probably damaging 1.00
IGL03149:Prkcq APN 2 11232545 missense probably benign 0.11
celina UTSW 2 11283849 missense possibly damaging 0.82
celina2 UTSW 2 11226986 critical splice donor site probably null
3-1:Prkcq UTSW 2 11300094 missense probably damaging 1.00
K3955:Prkcq UTSW 2 11246793 splice site probably benign
R0049:Prkcq UTSW 2 11283832 missense probably benign 0.04
R0049:Prkcq UTSW 2 11283832 missense probably benign 0.04
R0183:Prkcq UTSW 2 11253162 missense probably damaging 1.00
R0366:Prkcq UTSW 2 11246838 splice site probably benign
R0388:Prkcq UTSW 2 11254234 missense probably benign
R1385:Prkcq UTSW 2 11256286 missense probably damaging 1.00
R1687:Prkcq UTSW 2 11290533 missense probably damaging 1.00
R1693:Prkcq UTSW 2 11254199 missense probably damaging 0.99
R1760:Prkcq UTSW 2 11300070 missense probably damaging 1.00
R1764:Prkcq UTSW 2 11232631 missense probably damaging 1.00
R1968:Prkcq UTSW 2 11245397 missense probably damaging 1.00
R2020:Prkcq UTSW 2 11279521 missense probably benign
R2108:Prkcq UTSW 2 11232569 missense probably damaging 1.00
R2762:Prkcq UTSW 2 11232640 missense possibly damaging 0.75
R3402:Prkcq UTSW 2 11283849 missense possibly damaging 0.82
R3429:Prkcq UTSW 2 11246970 missense probably damaging 1.00
R3545:Prkcq UTSW 2 11283816 missense probably benign 0.11
R3893:Prkcq UTSW 2 11226971 missense probably damaging 1.00
R4086:Prkcq UTSW 2 11283868 missense probably damaging 0.97
R4423:Prkcq UTSW 2 11256169 missense possibly damaging 0.66
R4541:Prkcq UTSW 2 11283812 missense possibly damaging 0.84
R4649:Prkcq UTSW 2 11279522 missense possibly damaging 0.83
R4652:Prkcq UTSW 2 11279522 missense possibly damaging 0.83
R4820:Prkcq UTSW 2 11226986 critical splice donor site probably null
R5197:Prkcq UTSW 2 11299416 missense probably damaging 1.00
R6008:Prkcq UTSW 2 11256286 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAACAGCCATTCGTGG -3'
(R):5'- CCCATTTGTGTGTCTGCAACTG -3'

Sequencing Primer
(F):5'- AACAGCCATTCGTGGTCAGC -3'
(R):5'- GTGTGTCTGCAACTGGAAAATACTCC -3'
Posted On2015-02-19