Incidental Mutation 'R3547:Zfp831'
ID268230
Institutional Source Beutler Lab
Gene Symbol Zfp831
Ensembl Gene ENSMUSG00000050600
Gene Namezinc finger protein 831
SynonymsENSMUSG00000050600, OTTMUSG00000017459
MMRRC Submission 040666-MU
Accession Numbers

Genbank: NM_001099328; MGI: 3641861

Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R3547 (G1)
Quality Score199
Status Validated
Chromosome2
Chromosomal Location174643534-174710832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174657683 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1265 (S1265G)
Ref Sequence ENSEMBL: ENSMUSP00000060255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059452]
Predicted Effect probably benign
Transcript: ENSMUST00000059452
AA Change: S1265G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060255
Gene: ENSMUSG00000050600
AA Change: S1265G

DomainStartEndE-ValueType
low complexity region 120 135 N/A INTRINSIC
ZnF_C2H2 143 165 5.06e-2 SMART
ZnF_C2H2 171 195 7.78e-3 SMART
low complexity region 201 216 N/A INTRINSIC
low complexity region 237 248 N/A INTRINSIC
low complexity region 345 371 N/A INTRINSIC
low complexity region 383 392 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
low complexity region 717 736 N/A INTRINSIC
low complexity region 856 870 N/A INTRINSIC
low complexity region 1520 1529 N/A INTRINSIC
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109I03Rik C A 15: 74,881,614 A18S probably null Het
Alg5 A G 3: 54,749,315 R316G probably benign Het
Anapc1 T C 2: 128,642,682 N1121D possibly damaging Het
Antxr2 A T 5: 97,977,657 I247N probably benign Het
Arid5b C T 10: 68,098,462 G294S probably benign Het
Arl9 A G 5: 77,010,479 D136G probably benign Het
Atxn1l A G 8: 109,732,349 L427P possibly damaging Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Clec4a3 A G 6: 122,964,280 E78G probably damaging Het
Clip1 A G 5: 123,631,078 L532P probably damaging Het
Col12a1 T G 9: 79,633,416 K2429T probably damaging Het
Col20a1 G T 2: 180,994,911 E228D probably damaging Het
Cx3cl1 A C 8: 94,778,124 E56A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Fhit T C 14: 9,870,095 T125A probably benign Het
Gdi1 T A X: 74,307,808 F175L possibly damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Gpr149 A T 3: 62,595,128 C436S probably benign Het
Grid2 T C 6: 64,320,021 V456A probably damaging Het
Gstcd G T 3: 133,084,838 T56K possibly damaging Het
Hydin G A 8: 110,582,067 G3995D possibly damaging Het
Igkv4-50 G A 6: 69,700,781 T113I probably benign Het
Igkv5-45 A G 6: 69,776,256 probably benign Het
Igsf10 G A 3: 59,330,541 H740Y probably benign Het
Igsf10 C A 3: 59,336,514 R133L probably damaging Het
Lcmt1 A G 7: 123,400,479 E94G probably benign Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Map3k3 C T 11: 106,142,553 Q211* probably null Het
Map4 T A 9: 110,052,198 F43L possibly damaging Het
Mcf2 T C X: 60,135,446 K74R probably damaging Het
Mylk G A 16: 34,880,168 V460I possibly damaging Het
Nat1 A G 8: 67,491,032 D23G possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Ncf1 T A 5: 134,226,609 K143* probably null Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr549 A G 7: 102,554,470 Y62C probably damaging Het
Pi4k2a C T 19: 42,090,548 P16L probably benign Het
Pitx3 T A 19: 46,136,109 Q273L possibly damaging Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Prickle2 T C 6: 92,411,137 Y428C probably damaging Het
Prkcq A G 2: 11,283,816 K527E probably benign Het
Prune2 T A 19: 17,124,348 S2405R probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rnf167 T C 11: 70,649,681 I129T possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfxn2 T C 19: 46,590,196 S217P probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Slc22a17 A G 14: 54,907,237 L573P probably damaging Het
Slc25a45 T C 19: 5,884,546 Y181H probably damaging Het
Slc6a20a A G 9: 123,660,502 S159P probably damaging Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Thnsl1 T G 2: 21,212,627 D397E probably benign Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ube4b T C 4: 149,335,116 D1045G probably damaging Het
Ugt8a A T 3: 125,867,382 L487* probably null Het
Uprt T A X: 104,483,328 L123H probably damaging Het
Usp9x T C X: 13,128,390 L940P probably benign Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Uty A C Y: 1,158,512 D463E possibly damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Vps13d T G 4: 145,074,975 T3558P probably damaging Het
Zfp319 A G 8: 95,328,817 S253P probably damaging Het
Other mutations in Zfp831
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Zfp831 APN 2 174646285 missense possibly damaging 0.86
IGL00091:Zfp831 APN 2 174645658 missense possibly damaging 0.73
IGL00764:Zfp831 APN 2 174645908 missense possibly damaging 0.72
IGL01538:Zfp831 APN 2 174644606 missense possibly damaging 0.72
IGL01700:Zfp831 APN 2 174644918 missense possibly damaging 0.86
IGL01718:Zfp831 APN 2 174643838 missense possibly damaging 0.86
IGL02221:Zfp831 APN 2 174643726 missense probably benign 0.33
IGL02250:Zfp831 APN 2 174648201 missense possibly damaging 0.53
IGL03209:Zfp831 APN 2 174645266 missense probably benign 0.40
D4043:Zfp831 UTSW 2 174645266 missense probably benign 0.40
FR4304:Zfp831 UTSW 2 174645481 small insertion probably benign
FR4340:Zfp831 UTSW 2 174645480 small insertion probably benign
FR4449:Zfp831 UTSW 2 174645471 small insertion probably benign
FR4449:Zfp831 UTSW 2 174645482 small insertion probably benign
FR4589:Zfp831 UTSW 2 174645468 small insertion probably benign
FR4737:Zfp831 UTSW 2 174645471 small insertion probably benign
FR4737:Zfp831 UTSW 2 174645476 small insertion probably benign
FR4737:Zfp831 UTSW 2 174645483 small insertion probably benign
IGL02802:Zfp831 UTSW 2 174645152 missense possibly damaging 0.73
P0028:Zfp831 UTSW 2 174645346 missense possibly damaging 0.53
R0631:Zfp831 UTSW 2 174645290 missense possibly damaging 0.53
R0644:Zfp831 UTSW 2 174645863 missense probably benign 0.33
R0782:Zfp831 UTSW 2 174646630 missense probably benign 0.06
R1156:Zfp831 UTSW 2 174646917 missense possibly damaging 0.53
R1280:Zfp831 UTSW 2 174704059 missense probably benign 0.00
R1709:Zfp831 UTSW 2 174645890 missense probably benign 0.33
R1883:Zfp831 UTSW 2 174704077 missense possibly damaging 0.53
R1884:Zfp831 UTSW 2 174704077 missense possibly damaging 0.53
R2127:Zfp831 UTSW 2 174648124 missense probably benign 0.33
R2137:Zfp831 UTSW 2 174705746 missense possibly damaging 0.53
R2268:Zfp831 UTSW 2 174644241 missense probably benign 0.01
R2330:Zfp831 UTSW 2 174648089 nonsense probably null
R3821:Zfp831 UTSW 2 174644023 missense possibly damaging 0.73
R4163:Zfp831 UTSW 2 174644029 missense possibly damaging 0.53
R4232:Zfp831 UTSW 2 174705654 missense possibly damaging 0.96
R4778:Zfp831 UTSW 2 174646807 missense possibly damaging 0.53
R4820:Zfp831 UTSW 2 174705304 missense possibly damaging 0.73
R4912:Zfp831 UTSW 2 174644624 missense probably damaging 1.00
R5119:Zfp831 UTSW 2 174705310 missense probably benign 0.18
R5152:Zfp831 UTSW 2 174644564 missense probably benign 0.33
R5723:Zfp831 UTSW 2 174645407 missense probably benign 0.23
R5741:Zfp831 UTSW 2 174645152 missense possibly damaging 0.73
R5888:Zfp831 UTSW 2 174643627 missense probably benign 0.18
R5975:Zfp831 UTSW 2 174644092 missense possibly damaging 0.93
R6092:Zfp831 UTSW 2 174705506 missense probably damaging 0.98
R6158:Zfp831 UTSW 2 174643858 missense possibly damaging 0.53
R6212:Zfp831 UTSW 2 174645868 missense possibly damaging 0.53
R6233:Zfp831 UTSW 2 174646697 missense possibly damaging 0.85
R6248:Zfp831 UTSW 2 174644515 missense possibly damaging 0.53
R6255:Zfp831 UTSW 2 174646421 missense possibly damaging 0.96
R6460:Zfp831 UTSW 2 174646567 missense possibly damaging 0.46
R6477:Zfp831 UTSW 2 174704167 missense probably benign
R6864:Zfp831 UTSW 2 174646740 missense possibly damaging 0.72
X0021:Zfp831 UTSW 2 174705869 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GAATCATCCTCTGCTAGGGAG -3'
(R):5'- AAAACCTCATTGTGGCCCTTC -3'

Sequencing Primer
(F):5'- CTCTGCTAGGGAGGAATTTCAAG -3'
(R):5'- TCCTGAATTAAATTCTAGGGCCTC -3'
Posted On2015-02-19