Incidental Mutation 'R3547:Gstcd'
ID268239
Institutional Source Beutler Lab
Gene Symbol Gstcd
Ensembl Gene ENSMUSG00000028018
Gene Nameglutathione S-transferase, C-terminal domain containing
Synonyms
MMRRC Submission 040666-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R3547 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location132981752-133092033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 133084838 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 56 (T56K)
Ref Sequence ENSEMBL: ENSMUSP00000079421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029651] [ENSMUST00000080583]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029651
AA Change: T56K

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029651
Gene: ENSMUSG00000028018
AA Change: T56K

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
low complexity region 168 181 N/A INTRINSIC
low complexity region 195 205 N/A INTRINSIC
low complexity region 208 229 N/A INTRINSIC
Pfam:GidB 417 515 9e-9 PFAM
Pfam:Methyltransf_32 424 548 1.1e-15 PFAM
Pfam:MTS 430 508 5.3e-6 PFAM
Pfam:Methyltransf_31 440 571 2.6e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000080583
AA Change: T56K

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079421
Gene: ENSMUSG00000028018
AA Change: T56K

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
low complexity region 168 181 N/A INTRINSIC
low complexity region 195 205 N/A INTRINSIC
low complexity region 208 229 N/A INTRINSIC
Pfam:GidB 418 516 1.5e-8 PFAM
Pfam:Methyltransf_32 424 548 1.1e-15 PFAM
Pfam:Methyltransf_31 440 569 2.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197381
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109I03Rik C A 15: 74,881,614 A18S probably null Het
Alg5 A G 3: 54,749,315 R316G probably benign Het
Anapc1 T C 2: 128,642,682 N1121D possibly damaging Het
Antxr2 A T 5: 97,977,657 I247N probably benign Het
Arid5b C T 10: 68,098,462 G294S probably benign Het
Arl9 A G 5: 77,010,479 D136G probably benign Het
Atxn1l A G 8: 109,732,349 L427P possibly damaging Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Clec4a3 A G 6: 122,964,280 E78G probably damaging Het
Clip1 A G 5: 123,631,078 L532P probably damaging Het
Col12a1 T G 9: 79,633,416 K2429T probably damaging Het
Col20a1 G T 2: 180,994,911 E228D probably damaging Het
Cx3cl1 A C 8: 94,778,124 E56A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Fhit T C 14: 9,870,095 T125A probably benign Het
Gdi1 T A X: 74,307,808 F175L possibly damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Gpr149 A T 3: 62,595,128 C436S probably benign Het
Grid2 T C 6: 64,320,021 V456A probably damaging Het
Hydin G A 8: 110,582,067 G3995D possibly damaging Het
Igkv4-50 G A 6: 69,700,781 T113I probably benign Het
Igkv5-45 A G 6: 69,776,256 probably benign Het
Igsf10 G A 3: 59,330,541 H740Y probably benign Het
Igsf10 C A 3: 59,336,514 R133L probably damaging Het
Lcmt1 A G 7: 123,400,479 E94G probably benign Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Map3k3 C T 11: 106,142,553 Q211* probably null Het
Map4 T A 9: 110,052,198 F43L possibly damaging Het
Mcf2 T C X: 60,135,446 K74R probably damaging Het
Mylk G A 16: 34,880,168 V460I possibly damaging Het
Nat1 A G 8: 67,491,032 D23G possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Ncf1 T A 5: 134,226,609 K143* probably null Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr549 A G 7: 102,554,470 Y62C probably damaging Het
Pi4k2a C T 19: 42,090,548 P16L probably benign Het
Pitx3 T A 19: 46,136,109 Q273L possibly damaging Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Prickle2 T C 6: 92,411,137 Y428C probably damaging Het
Prkcq A G 2: 11,283,816 K527E probably benign Het
Prune2 T A 19: 17,124,348 S2405R probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rnf167 T C 11: 70,649,681 I129T possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfxn2 T C 19: 46,590,196 S217P probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Slc22a17 A G 14: 54,907,237 L573P probably damaging Het
Slc25a45 T C 19: 5,884,546 Y181H probably damaging Het
Slc6a20a A G 9: 123,660,502 S159P probably damaging Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Thnsl1 T G 2: 21,212,627 D397E probably benign Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ube4b T C 4: 149,335,116 D1045G probably damaging Het
Ugt8a A T 3: 125,867,382 L487* probably null Het
Uprt T A X: 104,483,328 L123H probably damaging Het
Usp9x T C X: 13,128,390 L940P probably benign Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Uty A C Y: 1,158,512 D463E possibly damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Vps13d T G 4: 145,074,975 T3558P probably damaging Het
Zfp319 A G 8: 95,328,817 S253P probably damaging Het
Zfp831 A G 2: 174,657,683 S1265G probably benign Het
Other mutations in Gstcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Gstcd APN 3 132986414 missense probably damaging 0.96
IGL01800:Gstcd APN 3 133084574 critical splice donor site probably null
IGL02434:Gstcd APN 3 132996202 splice site probably benign
IGL02720:Gstcd APN 3 133071961 missense probably benign 0.00
R0367:Gstcd UTSW 3 132986377 splice site probably benign
R0378:Gstcd UTSW 3 132986408 missense probably damaging 1.00
R0382:Gstcd UTSW 3 132986408 missense probably damaging 1.00
R0465:Gstcd UTSW 3 132983144 missense probably benign 0.04
R1295:Gstcd UTSW 3 133005628 missense probably damaging 1.00
R1861:Gstcd UTSW 3 132983107 missense probably damaging 1.00
R2056:Gstcd UTSW 3 133082053 missense probably benign 0.00
R2331:Gstcd UTSW 3 132998880 missense probably damaging 0.98
R2513:Gstcd UTSW 3 133082320 missense possibly damaging 0.59
R2513:Gstcd UTSW 3 133082321 missense possibly damaging 0.87
R4022:Gstcd UTSW 3 133082068 missense probably damaging 1.00
R4713:Gstcd UTSW 3 132983099 missense probably damaging 1.00
R4877:Gstcd UTSW 3 133005553 splice site probably benign
R5152:Gstcd UTSW 3 133084956 missense possibly damaging 0.95
R5165:Gstcd UTSW 3 133084679 missense probably damaging 0.99
R6106:Gstcd UTSW 3 132998914 missense probably benign 0.02
R6177:Gstcd UTSW 3 133082073 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTTGAGGGCTCAGCTTCATAG -3'
(R):5'- TCTAGGTGACCCAATGACAACAG -3'

Sequencing Primer
(F):5'- AGGGCTCAGCTTCATAGGATTTTTG -3'
(R):5'- TGACCCAATGACAACAGAAGATG -3'
Posted On2015-02-19