Incidental Mutation 'R3547:Utp20'
ID268267
Institutional Source Beutler Lab
Gene Symbol Utp20
Ensembl Gene ENSMUSG00000004356
Gene NameUTP20 small subunit processome component
Synonyms3830408P06Rik, DRIM, mDRIM
MMRRC Submission 040666-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.979) question?
Stock #R3547 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location88746607-88826804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88782689 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1150 (K1150E)
Ref Sequence ENSEMBL: ENSMUSP00000004470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004470]
Predicted Effect probably damaging
Transcript: ENSMUST00000004470
AA Change: K1150E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004470
Gene: ENSMUSG00000004356
AA Change: K1150E

DomainStartEndE-ValueType
low complexity region 244 255 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 571 581 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
Pfam:DRIM 910 1534 2.6e-176 PFAM
low complexity region 1585 1598 N/A INTRINSIC
low complexity region 1705 1719 N/A INTRINSIC
low complexity region 2503 2513 N/A INTRINSIC
low complexity region 2589 2605 N/A INTRINSIC
low complexity region 2727 2737 N/A INTRINSIC
low complexity region 2746 2764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220275
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UTP20 is a component of the U3 small nucleolar RNA (snoRNA) (SNORD3A; MIM 180710) protein complex (U3 snoRNP) and is involved in 18S rRNA processing (Wang et al., 2007 [PubMed 17498821]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109I03Rik C A 15: 74,881,614 A18S probably null Het
Alg5 A G 3: 54,749,315 R316G probably benign Het
Anapc1 T C 2: 128,642,682 N1121D possibly damaging Het
Antxr2 A T 5: 97,977,657 I247N probably benign Het
Arid5b C T 10: 68,098,462 G294S probably benign Het
Arl9 A G 5: 77,010,479 D136G probably benign Het
Atxn1l A G 8: 109,732,349 L427P possibly damaging Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Clec4a3 A G 6: 122,964,280 E78G probably damaging Het
Clip1 A G 5: 123,631,078 L532P probably damaging Het
Col12a1 T G 9: 79,633,416 K2429T probably damaging Het
Col20a1 G T 2: 180,994,911 E228D probably damaging Het
Cx3cl1 A C 8: 94,778,124 E56A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Fhit T C 14: 9,870,095 T125A probably benign Het
Gdi1 T A X: 74,307,808 F175L possibly damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Gpr149 A T 3: 62,595,128 C436S probably benign Het
Grid2 T C 6: 64,320,021 V456A probably damaging Het
Gstcd G T 3: 133,084,838 T56K possibly damaging Het
Hydin G A 8: 110,582,067 G3995D possibly damaging Het
Igkv4-50 G A 6: 69,700,781 T113I probably benign Het
Igkv5-45 A G 6: 69,776,256 probably benign Het
Igsf10 G A 3: 59,330,541 H740Y probably benign Het
Igsf10 C A 3: 59,336,514 R133L probably damaging Het
Lcmt1 A G 7: 123,400,479 E94G probably benign Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Map3k3 C T 11: 106,142,553 Q211* probably null Het
Map4 T A 9: 110,052,198 F43L possibly damaging Het
Mcf2 T C X: 60,135,446 K74R probably damaging Het
Mylk G A 16: 34,880,168 V460I possibly damaging Het
Nat1 A G 8: 67,491,032 D23G possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Ncf1 T A 5: 134,226,609 K143* probably null Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr549 A G 7: 102,554,470 Y62C probably damaging Het
Pi4k2a C T 19: 42,090,548 P16L probably benign Het
Pitx3 T A 19: 46,136,109 Q273L possibly damaging Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Prickle2 T C 6: 92,411,137 Y428C probably damaging Het
Prkcq A G 2: 11,283,816 K527E probably benign Het
Prune2 T A 19: 17,124,348 S2405R probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rnf167 T C 11: 70,649,681 I129T possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfxn2 T C 19: 46,590,196 S217P probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Slc22a17 A G 14: 54,907,237 L573P probably damaging Het
Slc25a45 T C 19: 5,884,546 Y181H probably damaging Het
Slc6a20a A G 9: 123,660,502 S159P probably damaging Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Thnsl1 T G 2: 21,212,627 D397E probably benign Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ube4b T C 4: 149,335,116 D1045G probably damaging Het
Ugt8a A T 3: 125,867,382 L487* probably null Het
Uprt T A X: 104,483,328 L123H probably damaging Het
Usp9x T C X: 13,128,390 L940P probably benign Het
Uty A C Y: 1,158,512 D463E possibly damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Vps13d T G 4: 145,074,975 T3558P probably damaging Het
Zfp319 A G 8: 95,328,817 S253P probably damaging Het
Zfp831 A G 2: 174,657,683 S1265G probably benign Het
Other mutations in Utp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Utp20 APN 10 88825444 missense possibly damaging 0.90
IGL00858:Utp20 APN 10 88809125 missense possibly damaging 0.69
IGL00858:Utp20 APN 10 88809138 missense probably benign
IGL00946:Utp20 APN 10 88748315 missense possibly damaging 0.82
IGL01061:Utp20 APN 10 88770704 missense probably benign 0.13
IGL01399:Utp20 APN 10 88758302 critical splice donor site probably null
IGL01548:Utp20 APN 10 88764781 missense probably damaging 1.00
IGL01587:Utp20 APN 10 88787535 missense probably damaging 0.98
IGL01789:Utp20 APN 10 88798279 critical splice donor site probably null
IGL01819:Utp20 APN 10 88792687 missense probably damaging 1.00
IGL02070:Utp20 APN 10 88821877 splice site probably benign
IGL02231:Utp20 APN 10 88791168 missense probably damaging 1.00
IGL02244:Utp20 APN 10 88815956 splice site probably benign
IGL02367:Utp20 APN 10 88771853 unclassified probably benign
IGL02553:Utp20 APN 10 88764795 missense probably damaging 0.99
IGL02748:Utp20 APN 10 88817295 missense probably benign 0.00
IGL02831:Utp20 APN 10 88815908 missense probably benign
IGL02986:Utp20 APN 10 88775285 missense probably damaging 1.00
IGL02997:Utp20 APN 10 88814034 missense probably benign
IGL03105:Utp20 APN 10 88791096 missense probably benign 0.10
IGL03251:Utp20 APN 10 88817326 critical splice acceptor site probably null
IGL03337:Utp20 APN 10 88754566 missense probably benign
IGL03348:Utp20 APN 10 88758317 missense probably benign 0.09
IGL03381:Utp20 APN 10 88822005 missense probably damaging 0.99
R0037:Utp20 UTSW 10 88798404 missense probably benign 0.05
R0107:Utp20 UTSW 10 88778391 missense probably benign 0.03
R0197:Utp20 UTSW 10 88777516 missense probably benign 0.22
R0219:Utp20 UTSW 10 88764675 missense probably damaging 1.00
R0315:Utp20 UTSW 10 88807421 missense probably damaging 1.00
R0328:Utp20 UTSW 10 88767107 missense possibly damaging 0.82
R0329:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0330:Utp20 UTSW 10 88817979 missense probably benign 0.00
R0395:Utp20 UTSW 10 88818595 missense probably damaging 1.00
R0399:Utp20 UTSW 10 88820979 missense probably damaging 1.00
R0454:Utp20 UTSW 10 88822069 missense probably benign 0.00
R0456:Utp20 UTSW 10 88754573 missense possibly damaging 0.92
R0491:Utp20 UTSW 10 88760912 missense probably damaging 1.00
R0557:Utp20 UTSW 10 88748311 missense probably damaging 0.99
R0600:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R0616:Utp20 UTSW 10 88770751 missense probably benign 0.14
R1076:Utp20 UTSW 10 88772459 missense probably benign 0.36
R1076:Utp20 UTSW 10 88772543 missense possibly damaging 0.86
R1330:Utp20 UTSW 10 88801189 missense probably damaging 0.96
R1440:Utp20 UTSW 10 88819339 missense probably benign 0.19
R1529:Utp20 UTSW 10 88753006 missense probably damaging 1.00
R1554:Utp20 UTSW 10 88764737 nonsense probably null
R1621:Utp20 UTSW 10 88762871 missense probably benign
R1641:Utp20 UTSW 10 88757972 missense possibly damaging 0.82
R1709:Utp20 UTSW 10 88749297 missense probably benign 0.29
R1734:Utp20 UTSW 10 88767461 missense probably damaging 1.00
R1755:Utp20 UTSW 10 88809769 missense probably benign 0.01
R1775:Utp20 UTSW 10 88770808 missense probably benign
R1866:Utp20 UTSW 10 88762770 nonsense probably null
R1867:Utp20 UTSW 10 88749443 missense probably benign
R1901:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1902:Utp20 UTSW 10 88753026 missense probably benign 0.02
R1967:Utp20 UTSW 10 88816979 missense probably benign 0.03
R2060:Utp20 UTSW 10 88774795 missense probably damaging 0.98
R2102:Utp20 UTSW 10 88772917 missense probably damaging 0.99
R2110:Utp20 UTSW 10 88767451 critical splice donor site probably null
R2115:Utp20 UTSW 10 88786003 missense probably benign 0.02
R2128:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2129:Utp20 UTSW 10 88814055 missense probably damaging 0.99
R2180:Utp20 UTSW 10 88820939 missense probably damaging 0.98
R2280:Utp20 UTSW 10 88825503 splice site probably null
R2435:Utp20 UTSW 10 88820891 missense possibly damaging 0.89
R2914:Utp20 UTSW 10 88754475 critical splice donor site probably null
R3005:Utp20 UTSW 10 88777455 missense probably damaging 0.97
R3546:Utp20 UTSW 10 88782689 missense probably damaging 1.00
R3622:Utp20 UTSW 10 88757993 unclassified probably benign
R3737:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3738:Utp20 UTSW 10 88762806 missense probably benign 0.00
R3841:Utp20 UTSW 10 88775203 unclassified probably benign
R4034:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4035:Utp20 UTSW 10 88762806 missense probably benign 0.00
R4157:Utp20 UTSW 10 88761867 missense probably benign
R4243:Utp20 UTSW 10 88807325 critical splice donor site probably null
R4295:Utp20 UTSW 10 88754519 missense possibly damaging 0.54
R4632:Utp20 UTSW 10 88778261 missense probably damaging 1.00
R4633:Utp20 UTSW 10 88752952 missense probably benign
R4684:Utp20 UTSW 10 88807445 nonsense probably null
R4731:Utp20 UTSW 10 88754520 missense possibly damaging 0.93
R4735:Utp20 UTSW 10 88816918 missense possibly damaging 0.91
R4772:Utp20 UTSW 10 88809935 missense probably benign 0.09
R4912:Utp20 UTSW 10 88771960 missense probably benign 0.01
R4974:Utp20 UTSW 10 88816949 missense probably benign 0.08
R4991:Utp20 UTSW 10 88746934 missense probably benign 0.09
R5004:Utp20 UTSW 10 88748273 missense probably damaging 0.98
R5037:Utp20 UTSW 10 88775330 missense probably benign 0.00
R5043:Utp20 UTSW 10 88798746 missense possibly damaging 0.70
R5108:Utp20 UTSW 10 88768873 missense probably benign 0.00
R5138:Utp20 UTSW 10 88747377 missense probably damaging 0.96
R5252:Utp20 UTSW 10 88750670 missense probably benign 0.01
R5394:Utp20 UTSW 10 88772915 nonsense probably null
R5470:Utp20 UTSW 10 88817896 missense probably benign 0.14
R5558:Utp20 UTSW 10 88751467 missense probably damaging 1.00
R5678:Utp20 UTSW 10 88809117 missense probably benign 0.00
R5822:Utp20 UTSW 10 88817285 missense probably benign 0.00
R5866:Utp20 UTSW 10 88772559 missense possibly damaging 0.82
R5924:Utp20 UTSW 10 88815922 missense probably benign 0.00
R6026:Utp20 UTSW 10 88768679 missense probably benign 0.04
R6363:Utp20 UTSW 10 88757080 missense probably damaging 1.00
R6434:Utp20 UTSW 10 88772533 nonsense probably null
R6477:Utp20 UTSW 10 88768918 missense probably benign 0.05
R6480:Utp20 UTSW 10 88755186 critical splice donor site probably null
R6989:Utp20 UTSW 10 88778240 missense probably benign 0.00
R7033:Utp20 UTSW 10 88754475 critical splice donor site probably null
R7192:Utp20 UTSW 10 88772459 missense probably benign 0.09
R7236:Utp20 UTSW 10 88749342 missense probably benign 0.28
R7260:Utp20 UTSW 10 88751472 missense probably benign 0.39
R7317:Utp20 UTSW 10 88762935 missense possibly damaging 0.83
R7318:Utp20 UTSW 10 88813949 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GTGGTAGTCTATGCTGGCAAATT -3'
(R):5'- TTTCCTGCCACACAAACAAGAG -3'

Sequencing Primer
(F):5'- TATGCTGGCAAATTAAAAATAAAGGG -3'
(R):5'- TCTCTACAGAGATCAGGTGTGTG -3'
Posted On2015-02-19