Incidental Mutation 'R3547:2010109I03Rik'
ID268274
Institutional Source Beutler Lab
Gene Symbol 2010109I03Rik
Ensembl Gene ENSMUSG00000063522
Gene NameRIKEN cDNA 2010109I03 gene
Synonyms
MMRRC Submission 040666-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.028) question?
Stock #R3547 (G1)
Quality Score179
Status Validated
Chromosome15
Chromosomal Location74876987-74897021 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74881614 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 18 (A18S)
Ref Sequence ENSEMBL: ENSMUSP00000076264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077004]
Predicted Effect probably null
Transcript: ENSMUST00000077004
AA Change: A18S

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000076264
Gene: ENSMUSG00000063522
AA Change: A18S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LU 21 100 6.96e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190826
Meta Mutation Damage Score 0.614 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg5 A G 3: 54,749,315 R316G probably benign Het
Anapc1 T C 2: 128,642,682 N1121D possibly damaging Het
Antxr2 A T 5: 97,977,657 I247N probably benign Het
Arid5b C T 10: 68,098,462 G294S probably benign Het
Arl9 A G 5: 77,010,479 D136G probably benign Het
Atxn1l A G 8: 109,732,349 L427P possibly damaging Het
Celf3 T G 3: 94,488,538 C304G probably damaging Het
Clcc1 T A 3: 108,668,113 C169S probably benign Het
Clec4a3 A G 6: 122,964,280 E78G probably damaging Het
Clip1 A G 5: 123,631,078 L532P probably damaging Het
Col12a1 T G 9: 79,633,416 K2429T probably damaging Het
Col20a1 G T 2: 180,994,911 E228D probably damaging Het
Cx3cl1 A C 8: 94,778,124 E56A possibly damaging Het
Eprs G A 1: 185,379,742 probably null Het
Fap A C 2: 62,519,011 L478R probably damaging Het
Fhit T C 14: 9,870,095 T125A probably benign Het
Gdi1 T A X: 74,307,808 F175L possibly damaging Het
Golga7b T C 19: 42,267,071 M129T possibly damaging Het
Gpr149 A T 3: 62,595,128 C436S probably benign Het
Grid2 T C 6: 64,320,021 V456A probably damaging Het
Gstcd G T 3: 133,084,838 T56K possibly damaging Het
Hydin G A 8: 110,582,067 G3995D possibly damaging Het
Igkv4-50 G A 6: 69,700,781 T113I probably benign Het
Igkv5-45 A G 6: 69,776,256 probably benign Het
Igsf10 G A 3: 59,330,541 H740Y probably benign Het
Igsf10 C A 3: 59,336,514 R133L probably damaging Het
Lcmt1 A G 7: 123,400,479 E94G probably benign Het
Lrp1b A T 2: 40,600,288 L287H probably damaging Het
Map3k3 C T 11: 106,142,553 Q211* probably null Het
Map4 T A 9: 110,052,198 F43L possibly damaging Het
Mcf2 T C X: 60,135,446 K74R probably damaging Het
Mylk G A 16: 34,880,168 V460I possibly damaging Het
Nat1 A G 8: 67,491,032 D23G possibly damaging Het
Nbeal1 T C 1: 60,278,780 F1959L probably damaging Het
Ncf1 T A 5: 134,226,609 K143* probably null Het
Nlrp6 T G 7: 140,926,769 V849G probably benign Het
Olfr549 A G 7: 102,554,470 Y62C probably damaging Het
Pi4k2a C T 19: 42,090,548 P16L probably benign Het
Pitx3 T A 19: 46,136,109 Q273L possibly damaging Het
Ppp1r27 T A 11: 120,550,685 I90F probably damaging Het
Prickle2 T C 6: 92,411,137 Y428C probably damaging Het
Prkcq A G 2: 11,283,816 K527E probably benign Het
Prune2 T A 19: 17,124,348 S2405R probably damaging Het
Reln A G 5: 22,227,600 V134A possibly damaging Het
Rnf167 T C 11: 70,649,681 I129T possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sfxn2 T C 19: 46,590,196 S217P probably damaging Het
Slc16a7 T A 10: 125,294,700 K39* probably null Het
Slc22a17 A G 14: 54,907,237 L573P probably damaging Het
Slc25a45 T C 19: 5,884,546 Y181H probably damaging Het
Slc6a20a A G 9: 123,660,502 S159P probably damaging Het
Tbc1d1 G A 5: 64,286,007 R523Q probably damaging Het
Thnsl1 T G 2: 21,212,627 D397E probably benign Het
Ttn T A 2: 76,745,106 I25148F probably damaging Het
Ube4b T C 4: 149,335,116 D1045G probably damaging Het
Ugt8a A T 3: 125,867,382 L487* probably null Het
Uprt T A X: 104,483,328 L123H probably damaging Het
Usp9x T C X: 13,128,390 L940P probably benign Het
Utp20 T C 10: 88,782,689 K1150E probably damaging Het
Uty A C Y: 1,158,512 D463E possibly damaging Het
Vmn1r7 A G 6: 57,024,849 I142T possibly damaging Het
Vps13d T G 4: 145,074,975 T3558P probably damaging Het
Zfp319 A G 8: 95,328,817 S253P probably damaging Het
Zfp831 A G 2: 174,657,683 S1265G probably benign Het
Other mutations in 2010109I03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:2010109I03Rik APN 15 74879900 missense probably benign
IGL02550:2010109I03Rik APN 15 74880755 missense probably damaging 1.00
IGL02555:2010109I03Rik APN 15 74881608 splice site probably benign
R2905:2010109I03Rik UTSW 15 74879867 missense probably benign
R4777:2010109I03Rik UTSW 15 74880683 missense probably benign
R6432:2010109I03Rik UTSW 15 74879964 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTAAGGTGAGTGGAGGTACCC -3'
(R):5'- CCCAGAGATGACACATGTAGG -3'

Sequencing Primer
(F):5'- GGTACCCATGAAATGACTCTGTGTC -3'
(R):5'- CCCAGAGATGACACATGTAGGTAGTC -3'
Posted On2015-02-19