Incidental Mutation 'R3551:Dcaf7'
ID268356
Institutional Source Beutler Lab
Gene Symbol Dcaf7
Ensembl Gene ENSMUSG00000049354
Gene NameDDB1 and CUL4 associated factor 7
Synonyms1700012F10Rik, 2610037L01Rik, Wdr68
MMRRC Submission 040668-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R3551 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location106036872-106059324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106054796 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 324 (T324A)
Ref Sequence ENSEMBL: ENSMUSP00000058168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058438]
Predicted Effect probably benign
Transcript: ENSMUST00000058438
AA Change: T324A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058168
Gene: ENSMUSG00000049354
AA Change: T324A

DomainStartEndE-ValueType
WD40 58 99 3.42e1 SMART
WD40 104 149 1.43e1 SMART
WD40 163 205 3.81e-5 SMART
WD40 211 251 1.1e2 SMART
WD40 255 295 8.88e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135857
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple WD40 repeats which facilitate protein-protein interactions and thereby enable the assembly of multiprotein complexes. This protein has been shown to function as a scaffold protein for protein complexes involved in kinase signaling. This highly conserved gene is present in eukaryotic plants, fungi, and animals. The ortholog of this gene was first identified in plants as a key regulator of anthocyanin biosynthesis and flower pigmentation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Adam24 G C 8: 40,679,593 W33C probably benign Het
Adgrl2 A T 3: 148,858,963 V327E probably damaging Het
Aqp7 T A 4: 41,045,329 N17I probably benign Het
Bicra T A 7: 15,979,733 Q848L probably benign Het
C4b T C 17: 34,741,872 E240G possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Clca3a2 T A 3: 144,803,081 N50I probably damaging Het
Dnah12 G A 14: 26,770,972 R1230H probably benign Het
Dsg4 G A 18: 20,451,756 V176M probably damaging Het
Ect2l A G 10: 18,163,393 I339T probably damaging Het
Edc4 A T 8: 105,885,494 I138F probably damaging Het
Ercc6l2 T A 13: 63,844,595 V401E probably damaging Het
Gm3269 T A 14: 4,845,893 V260D possibly damaging Het
Gm4076 C T 13: 85,127,150 noncoding transcript Het
Gm4922 A T 10: 18,784,496 N159K probably benign Het
Gm5134 G T 10: 76,000,447 A421S probably benign Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Ipo4 A G 14: 55,633,103 V288A probably benign Het
Kng2 A G 16: 23,011,995 probably null Het
Lrfn1 T C 7: 28,460,054 L466P possibly damaging Het
Magi1 T A 6: 93,699,629 K916N probably damaging Het
Mms19 T C 19: 41,949,798 T720A probably benign Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Npas2 A T 1: 39,287,562 M43L probably benign Het
Nup43 A G 10: 7,675,014 D216G possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Pear1 A G 3: 87,758,132 F145L probably benign Het
Pgap1 A G 1: 54,530,143 S355P possibly damaging Het
Prr14l A T 5: 32,828,619 probably null Het
Ptpn12 T C 5: 20,989,049 K742E possibly damaging Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Sema4c G C 1: 36,553,723 T138S probably benign Het
Slc4a2 C T 5: 24,430,101 T168M probably benign Het
Spice1 G T 16: 44,357,869 S85I probably damaging Het
Thrb T A 14: 17,963,214 I59N probably damaging Het
Trav7-1 A G 14: 52,655,299 D103G probably damaging Het
Ubap2l G T 3: 90,015,451 T766N unknown Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp759 T C 13: 67,138,967 V194A probably benign Het
Other mutations in Dcaf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Dcaf7 APN 11 106054746 missense probably damaging 1.00
IGL01584:Dcaf7 APN 11 106053827 missense probably benign 0.12
IGL02398:Dcaf7 APN 11 106053753 missense probably benign 0.03
IGL02516:Dcaf7 APN 11 106051872 missense probably damaging 1.00
IGL02672:Dcaf7 APN 11 106054858 utr 3 prime probably benign
IGL02892:Dcaf7 APN 11 106046692 missense possibly damaging 0.95
IGL02953:Dcaf7 APN 11 106051876 nonsense probably null
R0179:Dcaf7 UTSW 11 106051797 missense probably damaging 0.98
R0539:Dcaf7 UTSW 11 106051826 missense probably damaging 0.98
R1471:Dcaf7 UTSW 11 106046747 missense probably benign 0.01
R1647:Dcaf7 UTSW 11 106051802 missense probably damaging 1.00
R1648:Dcaf7 UTSW 11 106051802 missense probably damaging 1.00
R4656:Dcaf7 UTSW 11 106053798 missense probably damaging 1.00
R6167:Dcaf7 UTSW 11 106037251 missense probably damaging 0.99
R6192:Dcaf7 UTSW 11 106051758 missense probably damaging 1.00
R6782:Dcaf7 UTSW 11 106054755 missense probably damaging 1.00
R6864:Dcaf7 UTSW 11 106046821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCTCCAGATGCAAGATTG -3'
(R):5'- GTAACTGGCCTGGACTTCTACAG -3'

Sequencing Primer
(F):5'- CCAGATGCAAGATTGTTACCCCATTG -3'
(R):5'- GGACTTCTACAGCAGCTTCTGAAC -3'
Posted On2015-02-19