Incidental Mutation 'R3551:C4b'
ID268365
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
MMRRC Submission 040668-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3551 (G1)
Quality Score210
Status Not validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34741872 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 240 (E240G)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069507
AA Change: E240G

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: E240G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174597
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Adam24 G C 8: 40,679,593 W33C probably benign Het
Adgrl2 A T 3: 148,858,963 V327E probably damaging Het
Aqp7 T A 4: 41,045,329 N17I probably benign Het
Bicra T A 7: 15,979,733 Q848L probably benign Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Clca3a2 T A 3: 144,803,081 N50I probably damaging Het
Dcaf7 A G 11: 106,054,796 T324A probably benign Het
Dnah12 G A 14: 26,770,972 R1230H probably benign Het
Dsg4 G A 18: 20,451,756 V176M probably damaging Het
Ect2l A G 10: 18,163,393 I339T probably damaging Het
Edc4 A T 8: 105,885,494 I138F probably damaging Het
Ercc6l2 T A 13: 63,844,595 V401E probably damaging Het
Gm3269 T A 14: 4,845,893 V260D possibly damaging Het
Gm4076 C T 13: 85,127,150 noncoding transcript Het
Gm4922 A T 10: 18,784,496 N159K probably benign Het
Gm5134 G T 10: 76,000,447 A421S probably benign Het
Gm5724 T C 6: 141,708,596 K647E probably benign Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Ipo4 A G 14: 55,633,103 V288A probably benign Het
Kng2 A G 16: 23,011,995 probably null Het
Lrfn1 T C 7: 28,460,054 L466P possibly damaging Het
Magi1 T A 6: 93,699,629 K916N probably damaging Het
Mms19 T C 19: 41,949,798 T720A probably benign Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Npas2 A T 1: 39,287,562 M43L probably benign Het
Nup43 A G 10: 7,675,014 D216G possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Pear1 A G 3: 87,758,132 F145L probably benign Het
Pgap1 A G 1: 54,530,143 S355P possibly damaging Het
Prr14l A T 5: 32,828,619 probably null Het
Ptpn12 T C 5: 20,989,049 K742E possibly damaging Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Sema4c G C 1: 36,553,723 T138S probably benign Het
Slc4a2 C T 5: 24,430,101 T168M probably benign Het
Spice1 G T 16: 44,357,869 S85I probably damaging Het
Thrb T A 14: 17,963,214 I59N probably damaging Het
Trav7-1 A G 14: 52,655,299 D103G probably damaging Het
Ubap2l G T 3: 90,015,451 T766N unknown Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp759 T C 13: 67,138,967 V194A probably benign Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCTGTTGTCATGGGGAGAC -3'
(R):5'- GTTCTCAGATGGACTGGAGTC -3'

Sequencing Primer
(F):5'- AACTTAGCCCAGTCAGTGAGTTC -3'
(R):5'- GTCCAATAGGAGCACCCACTTTG -3'
Posted On2015-02-19