Incidental Mutation 'R3614:Asic4'
ID268369
Institutional Source Beutler Lab
Gene Symbol Asic4
Ensembl Gene ENSMUSG00000033007
Gene Nameacid-sensing (proton-gated) ion channel family member 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3614 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location75450436-75474343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75473058 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 444 (D444G)
Ref Sequence ENSEMBL: ENSMUSP00000109207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037708] [ENSMUST00000079205] [ENSMUST00000094818] [ENSMUST00000113577] [ENSMUST00000124042] [ENSMUST00000138683]
Predicted Effect probably damaging
Transcript: ENSMUST00000037708
AA Change: D463G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045598
Gene: ENSMUSG00000033007
AA Change: D463G

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
Pfam:ASC 45 464 5.3e-92 PFAM
low complexity region 507 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079205
SMART Domains Protein: ENSMUSP00000078199
Gene: ENSMUSG00000032997

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
Pfam:CHGN 262 761 5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094818
SMART Domains Protein: ENSMUSP00000092412
Gene: ENSMUSG00000032997

DomainStartEndE-ValueType
Pfam:CHGN 100 599 3.3e-174 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113577
AA Change: D444G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109207
Gene: ENSMUSG00000033007
AA Change: D444G

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
Pfam:ASC 45 346 5.5e-94 PFAM
Pfam:ASC 344 446 1.4e-42 PFAM
low complexity region 488 514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124042
SMART Domains Protein: ENSMUSP00000122057
Gene: ENSMUSG00000032997

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138683
SMART Domains Protein: ENSMUSP00000117253
Gene: ENSMUSG00000032997

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194916
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the superfamily of acid-sensing ion channels, which are proton-gated, amiloride-sensitive sodium channels. These channels have been implicated in synaptic transmission, pain perception as well as mechanoperception. This gene is predominantly expressed in the pituitary gland, and was considered a candidate for paroxysmal dystonic choreoathetosis (PDC), a movement disorder, however, no correlation was found between mutations in this gene and PDC. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous knockout increases the fear response in the predator-odor induced fear test and increases anxiety in open field and elevated plus maze tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A G 1: 165,575,727 Y1598C probably benign Het
Cd3g A G 9: 44,980,289 F11S probably benign Het
Dsp A G 13: 38,177,199 T365A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Golga3 C A 5: 110,220,908 Q1365K probably damaging Het
Lama3 T A 18: 12,448,288 H601Q probably benign Het
Lmbrd2 A G 15: 9,177,711 D499G probably damaging Het
Olfr171 A G 16: 19,624,765 C112R probably damaging Het
Otop2 G A 11: 115,329,146 A271T probably benign Het
Pigp T C 16: 94,364,724 D113G possibly damaging Het
Prex1 G A 2: 166,609,781 R256C probably damaging Het
Stxbp2 T A 8: 3,631,196 V10E possibly damaging Het
Vmn1r67 T C 7: 10,447,429 Y207H probably damaging Het
Other mutations in Asic4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Asic4 APN 1 75469146 missense possibly damaging 0.94
IGL01470:Asic4 APN 1 75450866 missense probably damaging 1.00
IGL02645:Asic4 APN 1 75473354 unclassified probably benign
IGL03002:Asic4 APN 1 75451323 missense possibly damaging 0.61
positron UTSW 1 75473043 nonsense probably null
PIT4445001:Asic4 UTSW 1 75451127 missense probably benign 0.03
R0106:Asic4 UTSW 1 75451127 missense probably benign 0.03
R0138:Asic4 UTSW 1 75469687 missense possibly damaging 0.87
R0453:Asic4 UTSW 1 75473511 unclassified probably benign
R0573:Asic4 UTSW 1 75469102 splice site probably benign
R0705:Asic4 UTSW 1 75451370 missense probably damaging 1.00
R1892:Asic4 UTSW 1 75469482 missense probably damaging 1.00
R1912:Asic4 UTSW 1 75469232 missense possibly damaging 0.93
R3790:Asic4 UTSW 1 75469841 unclassified probably benign
R3923:Asic4 UTSW 1 75451227 missense probably damaging 1.00
R4447:Asic4 UTSW 1 75470370 unclassified probably benign
R5177:Asic4 UTSW 1 75450839 missense probably damaging 1.00
R5208:Asic4 UTSW 1 75451226 missense probably damaging 1.00
R5266:Asic4 UTSW 1 75450923 missense probably benign 0.03
R5436:Asic4 UTSW 1 75451319 missense probably benign 0.09
R5921:Asic4 UTSW 1 75451373 missense probably benign 0.30
R6086:Asic4 UTSW 1 75473243 missense possibly damaging 0.64
R6512:Asic4 UTSW 1 75473043 nonsense probably null
R6530:Asic4 UTSW 1 75472335 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCCCTAACTTCTGAAGCCATG -3'
(R):5'- TGATCTTCCAGGTTGCCAGG -3'

Sequencing Primer
(F):5'- GAACAGCAAGCCGCCTATGG -3'
(R):5'- ATCCCAGGAGACCTTGCAG -3'
Posted On2015-02-19