Mutagenetix > Incidental Mutation

Incidental Mutation 'R3614:Asic4'

268369

Institutional Source

Beutler Lab

Gene Symbol

Asic4

Ensembl Gene

ENSMUSG00000033007

Gene Name

acid-sensing ion channel family member 4

Synonyms

Accn4

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3614 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75427080-75450987 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75449702 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 444 (D444G)

Ref Sequence

ENSEMBL: ENSMUSP00000109207 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037708] [ENSMUST00000079205] [ENSMUST00000094818] [ENSMUST00000113577] [ENSMUST00000124042] [ENSMUST00000138683]

AlphaFold

Q7TNS7

Predicted Effect

probably damaging
Transcript: ENSMUST00000037708
AA Change: D463G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045598
Gene: ENSMUSG00000033007
AA Change: D463G

Domain	Start	End	E-Value	Type
low complexity region	12	26	N/A	INTRINSIC
Pfam:ASC	45	464	5.3e-92	PFAM
low complexity region	507	533	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000079205

SMART Domains

Protein: ENSMUSP00000078199
Gene: ENSMUSG00000032997

Domain	Start	End	E-Value	Type
low complexity region	37	46	N/A	INTRINSIC
Pfam:CHGN	262	761	5e-150	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000094818

SMART Domains

Protein: ENSMUSP00000092412
Gene: ENSMUSG00000032997

Domain	Start	End	E-Value	Type
Pfam:CHGN	100	599	3.3e-174	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113577
AA Change: D444G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109207
Gene: ENSMUSG00000033007
AA Change: D444G

Domain	Start	End	E-Value	Type
low complexity region	12	26	N/A	INTRINSIC
Pfam:ASC	45	346	5.5e-94	PFAM
Pfam:ASC	344	446	1.4e-42	PFAM
low complexity region	488	514	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124042

SMART Domains

Protein: ENSMUSP00000122057
Gene: ENSMUSG00000032997

Domain	Start	End	E-Value	Type
low complexity region	37	46	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000138683

SMART Domains

Protein: ENSMUSP00000117253
Gene: ENSMUSG00000032997

Domain	Start	End	E-Value	Type
low complexity region	37	46	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143496

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194916

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the superfamily of acid-sensing ion channels, which are proton-gated, amiloride-sensitive sodium channels. These channels have been implicated in synaptic transmission, pain perception as well as mechanoperception. This gene is predominantly expressed in the pituitary gland, and was considered a candidate for paroxysmal dystonic choreoathetosis (PDC), a movement disorder, however, no correlation was found between mutations in this gene and PDC. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous knockout increases the fear response in the predator-odor induced fear test and increases anxiety in open field and elevated plus maze tests. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy10	A	G	1: 165,403,296 (GRCm39)	Y1598C	probably benign	Het
Cd3g	A	G	9: 44,891,587 (GRCm39)	F11S	probably benign	Het
Dsp	A	G	13: 38,361,175 (GRCm39)	T365A	probably damaging	Het
Fabp3	C	T	4: 130,206,180 (GRCm39)	T57I	probably benign	Het
Golga3	C	A	5: 110,368,774 (GRCm39)	Q1365K	probably damaging	Het
Lama3	T	A	18: 12,581,345 (GRCm39)	H601Q	probably benign	Het
Lmbrd2	A	G	15: 9,177,798 (GRCm39)	D499G	probably damaging	Het
Or2aj6	A	G	16: 19,443,515 (GRCm39)	C112R	probably damaging	Het
Otop2	G	A	11: 115,219,972 (GRCm39)	A271T	probably benign	Het
Pigp	T	C	16: 94,165,583 (GRCm39)	D113G	possibly damaging	Het
Prex1	G	A	2: 166,451,701 (GRCm39)	R256C	probably damaging	Het
Stxbp2	T	A	8: 3,681,196 (GRCm39)	V10E	possibly damaging	Het
Vmn1r67	T	C	7: 10,181,356 (GRCm39)	Y207H	probably damaging	Het

Other mutations in Asic4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Asic4	APN	1	75,445,790 (GRCm39)	missense	possibly damaging	0.94
IGL01470:Asic4	APN	1	75,427,510 (GRCm39)	missense	probably damaging	1.00
IGL02645:Asic4	APN	1	75,449,998 (GRCm39)	unclassified	probably benign
IGL03002:Asic4	APN	1	75,427,967 (GRCm39)	missense	possibly damaging	0.61
positron	UTSW	1	75,449,687 (GRCm39)	nonsense	probably null
PIT4445001:Asic4	UTSW	1	75,427,771 (GRCm39)	missense	probably benign	0.03
R0106:Asic4	UTSW	1	75,427,771 (GRCm39)	missense	probably benign	0.03
R0138:Asic4	UTSW	1	75,446,331 (GRCm39)	missense	possibly damaging	0.87
R0453:Asic4	UTSW	1	75,450,155 (GRCm39)	unclassified	probably benign
R0573:Asic4	UTSW	1	75,445,746 (GRCm39)	splice site	probably benign
R0705:Asic4	UTSW	1	75,428,014 (GRCm39)	missense	probably damaging	1.00
R1892:Asic4	UTSW	1	75,446,126 (GRCm39)	missense	probably damaging	1.00
R1912:Asic4	UTSW	1	75,445,876 (GRCm39)	missense	possibly damaging	0.93
R3790:Asic4	UTSW	1	75,446,485 (GRCm39)	unclassified	probably benign
R3923:Asic4	UTSW	1	75,427,871 (GRCm39)	missense	probably damaging	1.00
R4447:Asic4	UTSW	1	75,447,014 (GRCm39)	unclassified	probably benign
R5177:Asic4	UTSW	1	75,427,483 (GRCm39)	missense	probably damaging	1.00
R5208:Asic4	UTSW	1	75,427,870 (GRCm39)	missense	probably damaging	1.00
R5266:Asic4	UTSW	1	75,427,567 (GRCm39)	missense	probably benign	0.03
R5436:Asic4	UTSW	1	75,427,963 (GRCm39)	missense	probably benign	0.09
R5921:Asic4	UTSW	1	75,428,017 (GRCm39)	missense	probably benign	0.30
R6086:Asic4	UTSW	1	75,449,887 (GRCm39)	missense	possibly damaging	0.64
R6512:Asic4	UTSW	1	75,449,687 (GRCm39)	nonsense	probably null
R6530:Asic4	UTSW	1	75,448,979 (GRCm39)	missense	probably damaging	0.98
R7545:Asic4	UTSW	1	75,449,060 (GRCm39)	missense	probably damaging	0.98
R9129:Asic4	UTSW	1	75,446,469 (GRCm39)	missense	possibly damaging	0.77
R9322:Asic4	UTSW	1	75,446,462 (GRCm39)	missense	probably benign	0.38
Z1177:Asic4	UTSW	1	75,445,864 (GRCm39)	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GCCCTAACTTCTGAAGCCATG -3'
(R):5'- TGATCTTCCAGGTTGCCAGG -3'

Sequencing Primer
(F):5'- GAACAGCAAGCCGCCTATGG -3'
(R):5'- ATCCCAGGAGACCTTGCAG -3'

Posted On

2015-02-19