Incidental Mutation 'R3615:Nlrp10'
ID268434
Institutional Source Beutler Lab
Gene Symbol Nlrp10
Ensembl Gene ENSMUSG00000049709
Gene NameNLR family, pyrin domain containing 10
SynonymsNalp10, 6430548I20Rik, Pynod
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3615 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108921852-108930178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108924476 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 599 (F599S)
Ref Sequence ENSEMBL: ENSMUSP00000050252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055745]
PDB Structure
Solution structure of the Pyrin/PAAD-DAPIN domain in mouse NALP10 (NACHT, leucine rich repeat and PYD containing 10) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000055745
AA Change: F599S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050252
Gene: ENSMUSG00000049709
AA Change: F599S

DomainStartEndE-ValueType
PYRIN 9 88 4.13e-18 SMART
low complexity region 126 137 N/A INTRINSIC
AAA 161 302 1.07e-2 SMART
low complexity region 576 597 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). The protein encoded by this gene belongs to the NALP protein family despite lacking the LRR region. This protein likely plays a regulatory role in the innate immune system. The protein belongs to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. Other experiments indicate that this gene acts as a multifunctional negative regulator of inflammation and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display a global defect in adaptive immune responses with impaired dendritic cell migration to lymph nodes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,864 N399S probably benign Het
A2ml1 T C 6: 128,558,294 T818A probably benign Het
Aasdh A G 5: 76,888,782 V304A probably benign Het
Angptl3 G A 4: 99,034,465 A248T probably benign Het
Ap2b1 T A 11: 83,324,565 C112S possibly damaging Het
Aqr A T 2: 114,136,887 I549N probably damaging Het
Barhl1 C T 2: 28,911,550 D161N possibly damaging Het
Col28a1 A G 6: 8,014,942 V821A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dnah1 A G 14: 31,315,148 L247P possibly damaging Het
Dpysl2 T A 14: 66,834,370 H107L probably damaging Het
Dzip3 A G 16: 48,937,063 L869S probably damaging Het
Efs T C 14: 54,920,095 Y160C probably damaging Het
Enam A T 5: 88,504,447 N1197Y possibly damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam184b A G 5: 45,582,815 V343A possibly damaging Het
Fbxw26 A T 9: 109,743,760 Y105* probably null Het
Fiz1 A G 7: 5,008,172 L449P probably benign Het
Foxi2 T A 7: 135,410,451 C23S possibly damaging Het
Gdf2 G A 14: 33,944,957 R212Q probably damaging Het
Gm5105 C A 3: 138,049,688 A46S unknown Het
Gm597 T C 1: 28,776,575 D792G probably benign Het
Grik5 C T 7: 25,022,571 A581T probably benign Het
Gse1 C G 8: 120,572,742 probably benign Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Krt25 A C 11: 99,317,298 V368G possibly damaging Het
Lacc1 A G 14: 77,033,287 V269A probably benign Het
Lamc1 T C 1: 153,251,150 K417E probably damaging Het
Miip A G 4: 147,865,914 M75T probably benign Het
Nlrp12 T A 7: 3,240,575 M436L probably benign Het
Olfr142 T C 2: 90,252,409 E193G possibly damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Pla2g2e G A 4: 138,880,374 V22I probably benign Het
Plekhd1 A G 12: 80,717,270 E202G probably damaging Het
Prss21 A G 17: 23,872,831 T258A probably benign Het
Prss34 A G 17: 25,298,846 E65G probably benign Het
Psap A G 10: 60,294,603 N149S probably benign Het
Ptprf C T 4: 118,237,883 A275T probably benign Het
Sem1 A G 6: 6,578,520 L12P probably damaging Het
Sf3b3 A G 8: 110,844,523 Y4H probably damaging Het
Sh3bp4 G T 1: 89,137,705 R7L probably damaging Het
Slc16a1 T A 3: 104,653,570 L397Q probably damaging Het
Smg5 A G 3: 88,336,451 S10G possibly damaging Het
Tas2r102 C T 6: 132,762,818 Q230* probably null Het
Tdo2 A G 3: 81,975,428 Y13H possibly damaging Het
Tmem231 C T 8: 111,918,313 R187H possibly damaging Het
Tmem30b A G 12: 73,545,579 M254T probably damaging Het
Trpm1 G A 7: 64,243,570 G1057R probably damaging Het
Tusc3 A T 8: 39,164,838 K347N probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Vash2 T C 1: 190,970,419 Y117C probably damaging Het
Vrk2 A G 11: 26,489,866 I235T possibly damaging Het
Wdr20 A G 12: 110,793,939 T420A probably benign Het
Other mutations in Nlrp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Nlrp10 APN 7 108924581 missense possibly damaging 0.86
IGL01482:Nlrp10 APN 7 108926952 missense probably benign
IGL02043:Nlrp10 APN 7 108925502 missense probably damaging 0.99
IGL03129:Nlrp10 APN 7 108924911 missense probably damaging 1.00
IGL02835:Nlrp10 UTSW 7 108924662 missense possibly damaging 0.61
R0106:Nlrp10 UTSW 7 108925322 missense possibly damaging 0.94
R0106:Nlrp10 UTSW 7 108925322 missense possibly damaging 0.94
R0540:Nlrp10 UTSW 7 108924285 missense probably benign 0.26
R0607:Nlrp10 UTSW 7 108924285 missense probably benign 0.26
R1166:Nlrp10 UTSW 7 108925010 missense probably damaging 1.00
R1248:Nlrp10 UTSW 7 108925881 missense probably benign 0.08
R1450:Nlrp10 UTSW 7 108925388 missense probably damaging 0.98
R1459:Nlrp10 UTSW 7 108924348 missense probably benign
R1567:Nlrp10 UTSW 7 108927050 missense probably benign 0.02
R1635:Nlrp10 UTSW 7 108924530 missense possibly damaging 0.93
R1845:Nlrp10 UTSW 7 108927041 missense probably damaging 1.00
R1912:Nlrp10 UTSW 7 108925395 nonsense probably null
R1952:Nlrp10 UTSW 7 108924563 missense probably benign 0.20
R1953:Nlrp10 UTSW 7 108925118 missense probably benign 0.00
R2079:Nlrp10 UTSW 7 108925628 missense possibly damaging 0.66
R3616:Nlrp10 UTSW 7 108924476 missense probably benign
R4207:Nlrp10 UTSW 7 108924341 missense possibly damaging 0.56
R4786:Nlrp10 UTSW 7 108925238 missense probably damaging 1.00
R5048:Nlrp10 UTSW 7 108924565 missense probably benign 0.01
R5568:Nlrp10 UTSW 7 108924261 missense probably benign 0.00
R5993:Nlrp10 UTSW 7 108927013 missense probably benign 0.00
R6033:Nlrp10 UTSW 7 108924577 missense probably benign 0.17
R6033:Nlrp10 UTSW 7 108924577 missense probably benign 0.17
R6170:Nlrp10 UTSW 7 108924464 missense probably benign 0.00
R6320:Nlrp10 UTSW 7 108925746 missense possibly damaging 0.82
R6935:Nlrp10 UTSW 7 108926900 missense probably damaging 0.99
R7024:Nlrp10 UTSW 7 108925198 missense possibly damaging 0.73
R7081:Nlrp10 UTSW 7 108924648 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCACATGCTAAGACTCCTGG -3'
(R):5'- TCATGGGATCTGGAATTCTCTC -3'

Sequencing Primer
(F):5'- AAGTGTCTGTCCTTCCTCATC -3'
(R):5'- ATGGGATCTGGAATTCTCTCTCTATG -3'
Posted On2015-02-19