Incidental Mutation 'R3617:Ndufa9'
ID268475
Institutional Source Beutler Lab
Gene Symbol Ndufa9
Ensembl Gene ENSMUSG00000000399
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9
Synonyms
MMRRC Submission 040674-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.761) question?
Stock #R3617 (G1)
Quality Score223
Status Validated
Chromosome6
Chromosomal Location126821721-126849136 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 126849108 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088194] [ENSMUST00000095440] [ENSMUST00000202574] [ENSMUST00000202878] [ENSMUST00000205002]
Predicted Effect probably benign
Transcript: ENSMUST00000088194
SMART Domains Protein: ENSMUSP00000085523
Gene: ENSMUSG00000000399

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
Pfam:NmrA 56 204 1.9e-13 PFAM
Pfam:Epimerase 56 264 4.7e-11 PFAM
Pfam:3Beta_HSD 57 200 1.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095440
SMART Domains Protein: ENSMUSP00000093091
Gene: ENSMUSG00000030344

DomainStartEndE-ValueType
AKAP_110 5 864 N/A SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200890
Predicted Effect probably benign
Transcript: ENSMUST00000202574
SMART Domains Protein: ENSMUSP00000144405
Gene: ENSMUSG00000030344

DomainStartEndE-ValueType
AKAP_110 5 864 N/A SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202878
SMART Domains Protein: ENSMUSP00000143794
Gene: ENSMUSG00000030344

DomainStartEndE-ValueType
AKAP_110 5 864 N/A SMART
Predicted Effect unknown
Transcript: ENSMUST00000205002
AA Change: A2E
SMART Domains Protein: ENSMUSP00000144904
Gene: ENSMUSG00000000399
AA Change: A2E

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
Pfam:NmrA 56 204 1.9e-13 PFAM
Pfam:Epimerase 56 264 4.7e-11 PFAM
Pfam:3Beta_HSD 57 200 1.4e-11 PFAM
Meta Mutation Damage Score 0.292 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The encoded protein is a subunit of the hydrophobic protein fraction of the NADH:ubiquinone oxidoreductase (complex I), the first enzyme complex in the electron transport chain located in the inner mitochondrial membrane. A pseudogene has been identified on chromosome 12. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,679,289 V460A probably damaging Het
Aplf T C 6: 87,671,883 I25V possibly damaging Het
Ascc3 A G 10: 50,618,185 T239A probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cbfa2t2 A T 2: 154,436,984 probably benign Het
Cdkn1c C T 7: 143,459,794 probably benign Het
Cfap46 A G 7: 139,639,599 S1317P probably benign Het
Cntln C T 4: 85,004,977 Q560* probably null Het
Cntn2 G C 1: 132,528,623 A161G probably benign Het
Crybg1 A G 10: 43,956,786 I1991T possibly damaging Het
Cttnbp2 T C 6: 18,414,190 E952G probably damaging Het
Dhx36 T C 3: 62,472,007 T887A possibly damaging Het
Dhx36 A G 3: 62,487,060 F512L probably benign Het
Fthl17f A G X: 9,063,623 T153A probably benign Het
Gad1-ps T A 10: 99,445,398 noncoding transcript Het
Gba2 C T 4: 43,573,803 R163H probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm17019 A T 5: 15,031,067 M120K possibly damaging Het
Gm8251 T C 1: 44,060,954 D328G probably benign Het
Helz2 C T 2: 181,233,061 R1880H probably damaging Het
Ifi204 T C 1: 173,755,717 I312V possibly damaging Het
Kncn T C 4: 115,885,892 F55L probably benign Het
Kndc1 G A 7: 139,902,060 probably benign Het
Nat8f3 C A 6: 85,761,688 A31S probably benign Het
Ndst4 T C 3: 125,438,133 I117T probably benign Het
Nupl2 T C 5: 24,182,327 S372P probably benign Het
Pde6a A G 18: 61,231,503 probably benign Het
Pigw T C 11: 84,878,307 I65M probably damaging Het
Pip A G 6: 41,851,937 T139A probably benign Het
Rel A T 11: 23,745,780 D202E probably damaging Het
Rhot2 A G 17: 25,840,981 probably benign Het
Sh3rf3 G A 10: 59,086,863 R587Q possibly damaging Het
Sim1 T A 10: 50,909,528 M231K probably damaging Het
Slc12a9 G A 5: 137,332,497 T47M probably damaging Het
Slc4a4 A G 5: 89,234,804 D1036G probably benign Het
Tas2r143 A T 6: 42,401,063 I276F probably benign Het
Tgfbr3 A T 5: 107,140,619 F392Y possibly damaging Het
Tmem266 T C 9: 55,400,634 V148A probably damaging Het
Ubiad1 A G 4: 148,436,360 I269T probably benign Het
Vwc2l A G 1: 70,728,882 probably null Het
Zbtb49 G A 5: 38,200,631 probably benign Het
Other mutations in Ndufa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Ndufa9 APN 6 126844814 missense probably damaging 1.00
IGL02167:Ndufa9 APN 6 126844785 splice site probably benign
IGL02206:Ndufa9 APN 6 126844403 nonsense probably null
IGL03186:Ndufa9 APN 6 126844892 missense possibly damaging 0.47
IGL03356:Ndufa9 APN 6 126844850 missense possibly damaging 0.89
R0310:Ndufa9 UTSW 6 126827532 splice site probably benign
R1118:Ndufa9 UTSW 6 126822068 missense probably damaging 1.00
R1119:Ndufa9 UTSW 6 126822068 missense probably damaging 1.00
R1714:Ndufa9 UTSW 6 126822191 critical splice acceptor site probably null
R2207:Ndufa9 UTSW 6 126844809 missense probably damaging 1.00
R2483:Ndufa9 UTSW 6 126844399 missense possibly damaging 0.48
R3623:Ndufa9 UTSW 6 126844399 missense possibly damaging 0.48
R4619:Ndufa9 UTSW 6 126827535 splice site probably null
R4855:Ndufa9 UTSW 6 126827542 nonsense probably null
R4931:Ndufa9 UTSW 6 126836320 missense probably damaging 1.00
R4965:Ndufa9 UTSW 6 126822063 missense probably benign 0.01
R5109:Ndufa9 UTSW 6 126832557 splice site probably null
Predicted Primers PCR Primer
(F):5'- CACGCACTATCTCGAACCTGTC -3'
(R):5'- GGGACTGTATTTTCCCCTGC -3'

Sequencing Primer
(F):5'- AACCTGTCAGTGTCCGGGTTC -3'
(R):5'- GACTGTATTTTCCCCTGCCTTCTC -3'
Posted On2015-02-19