Incidental Mutation 'R3617:Sh3rf3'
ID268484
Institutional Source Beutler Lab
Gene Symbol Sh3rf3
Ensembl Gene ENSMUSG00000037990
Gene NameSH3 domain containing ring finger 3
SynonymsSh3md4, 4831416G18Rik
MMRRC Submission 040674-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R3617 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location58813359-59138916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59086863 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 587 (R587Q)
Ref Sequence ENSEMBL: ENSMUSP00000120938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153031]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152924
Predicted Effect possibly damaging
Transcript: ENSMUST00000153031
AA Change: R587Q

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120938
Gene: ENSMUSG00000037990
AA Change: R587Q

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
RING 52 92 2.76e-7 SMART
low complexity region 119 152 N/A INTRINSIC
low complexity region 161 170 N/A INTRINSIC
SH3 190 245 8.24e-18 SMART
SH3 252 311 5.56e-15 SMART
SH3 461 518 1.43e-17 SMART
low complexity region 707 739 N/A INTRINSIC
SH3 822 878 5.19e-15 SMART
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,679,289 V460A probably damaging Het
Aplf T C 6: 87,671,883 I25V possibly damaging Het
Ascc3 A G 10: 50,618,185 T239A probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cbfa2t2 A T 2: 154,436,984 probably benign Het
Cdkn1c C T 7: 143,459,794 probably benign Het
Cfap46 A G 7: 139,639,599 S1317P probably benign Het
Cntln C T 4: 85,004,977 Q560* probably null Het
Cntn2 G C 1: 132,528,623 A161G probably benign Het
Crybg1 A G 10: 43,956,786 I1991T possibly damaging Het
Cttnbp2 T C 6: 18,414,190 E952G probably damaging Het
Dhx36 T C 3: 62,472,007 T887A possibly damaging Het
Dhx36 A G 3: 62,487,060 F512L probably benign Het
Fthl17f A G X: 9,063,623 T153A probably benign Het
Gad1-ps T A 10: 99,445,398 noncoding transcript Het
Gba2 C T 4: 43,573,803 R163H probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Gm17019 A T 5: 15,031,067 M120K possibly damaging Het
Gm8251 T C 1: 44,060,954 D328G probably benign Het
Helz2 C T 2: 181,233,061 R1880H probably damaging Het
Ifi204 T C 1: 173,755,717 I312V possibly damaging Het
Kncn T C 4: 115,885,892 F55L probably benign Het
Kndc1 G A 7: 139,902,060 probably benign Het
Nat8f3 C A 6: 85,761,688 A31S probably benign Het
Ndst4 T C 3: 125,438,133 I117T probably benign Het
Ndufa9 G T 6: 126,849,108 probably benign Het
Nupl2 T C 5: 24,182,327 S372P probably benign Het
Pde6a A G 18: 61,231,503 probably benign Het
Pigw T C 11: 84,878,307 I65M probably damaging Het
Pip A G 6: 41,851,937 T139A probably benign Het
Rel A T 11: 23,745,780 D202E probably damaging Het
Rhot2 A G 17: 25,840,981 probably benign Het
Sim1 T A 10: 50,909,528 M231K probably damaging Het
Slc12a9 G A 5: 137,332,497 T47M probably damaging Het
Slc4a4 A G 5: 89,234,804 D1036G probably benign Het
Tas2r143 A T 6: 42,401,063 I276F probably benign Het
Tgfbr3 A T 5: 107,140,619 F392Y possibly damaging Het
Tmem266 T C 9: 55,400,634 V148A probably damaging Het
Ubiad1 A G 4: 148,436,360 I269T probably benign Het
Vwc2l A G 1: 70,728,882 probably null Het
Zbtb49 G A 5: 38,200,631 probably benign Het
Other mutations in Sh3rf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Sh3rf3 APN 10 59049356 missense probably benign 0.06
IGL01898:Sh3rf3 APN 10 59049530 missense probably damaging 0.99
IGL02108:Sh3rf3 APN 10 59135828 missense probably damaging 1.00
IGL02148:Sh3rf3 APN 10 59086740 missense probably benign 0.02
exasperated UTSW 10 59086824 missense probably benign 0.06
strained UTSW 10 59007103 missense probably damaging 1.00
R0421:Sh3rf3 UTSW 10 58984075 missense probably damaging 1.00
R1056:Sh3rf3 UTSW 10 59007082 missense probably damaging 1.00
R1313:Sh3rf3 UTSW 10 59071999 missense possibly damaging 0.92
R1313:Sh3rf3 UTSW 10 59071999 missense possibly damaging 0.92
R1615:Sh3rf3 UTSW 10 59131077 missense probably benign 0.02
R1797:Sh3rf3 UTSW 10 59086667 nonsense probably null
R1869:Sh3rf3 UTSW 10 59083513 missense probably damaging 1.00
R1924:Sh3rf3 UTSW 10 59104167 splice site probably benign
R1968:Sh3rf3 UTSW 10 58813987 missense probably benign 0.32
R2353:Sh3rf3 UTSW 10 59007073 missense probably damaging 1.00
R3769:Sh3rf3 UTSW 10 58984191 missense probably benign 0.07
R4059:Sh3rf3 UTSW 10 59083533 missense probably damaging 1.00
R4425:Sh3rf3 UTSW 10 59083576 missense probably benign 0.00
R4690:Sh3rf3 UTSW 10 58813704 missense possibly damaging 0.93
R4832:Sh3rf3 UTSW 10 58814083 missense probably benign 0.19
R4853:Sh3rf3 UTSW 10 59083519 missense probably damaging 1.00
R4854:Sh3rf3 UTSW 10 58813723 missense possibly damaging 0.93
R4917:Sh3rf3 UTSW 10 59007103 missense probably damaging 1.00
R4918:Sh3rf3 UTSW 10 59007103 missense probably damaging 1.00
R4995:Sh3rf3 UTSW 10 59086824 missense probably benign 0.06
R5125:Sh3rf3 UTSW 10 59131190 missense probably benign 0.14
R5640:Sh3rf3 UTSW 10 58813947 missense probably benign
R5716:Sh3rf3 UTSW 10 59131283 missense probably benign 0.03
R5756:Sh3rf3 UTSW 10 59104382 missense probably damaging 0.98
R5848:Sh3rf3 UTSW 10 58984153 missense possibly damaging 0.54
R5908:Sh3rf3 UTSW 10 59049448 missense probably benign 0.32
R5930:Sh3rf3 UTSW 10 59130986 missense probably damaging 1.00
R6036:Sh3rf3 UTSW 10 58813984 missense probably benign 0.19
R6036:Sh3rf3 UTSW 10 58813984 missense probably benign 0.19
R6392:Sh3rf3 UTSW 10 59007076 missense probably damaging 0.97
R6450:Sh3rf3 UTSW 10 58984144 missense probably damaging 1.00
R6470:Sh3rf3 UTSW 10 58983969 missense probably damaging 1.00
R6639:Sh3rf3 UTSW 10 59083467 missense probably damaging 1.00
R6685:Sh3rf3 UTSW 10 59086841 missense possibly damaging 0.95
R7292:Sh3rf3 UTSW 10 59071973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTTACCCTGGAATAATGTC -3'
(R):5'- CCCATGCTGGAGATCAGAAG -3'

Sequencing Primer
(F):5'- ACCCTGGAATAATGTCCTTGGAG -3'
(R):5'- TCAGAAGATTCCAGGTTACGC -3'
Posted On2015-02-19