Incidental Mutation 'R3618:Rgs8'
ID268496
Institutional Source Beutler Lab
Gene Symbol Rgs8
Ensembl Gene ENSMUSG00000042671
Gene Nameregulator of G-protein signaling 8
Synonyms6530413N01Rik
MMRRC Submission 040675-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R3618 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location153653025-153700323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 153690996 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 98 (T98A)
Ref Sequence ENSEMBL: ENSMUSP00000122518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041776] [ENSMUST00000111810] [ENSMUST00000111812] [ENSMUST00000111814] [ENSMUST00000111815] [ENSMUST00000124500] [ENSMUST00000147482] [ENSMUST00000147700] [ENSMUST00000152114]
Predicted Effect probably benign
Transcript: ENSMUST00000041776
AA Change: T98A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045715
Gene: ENSMUSG00000042671
AA Change: T98A

DomainStartEndE-ValueType
RGS 56 172 1.83e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111810
AA Change: T98A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107441
Gene: ENSMUSG00000042671
AA Change: T98A

DomainStartEndE-ValueType
RGS 56 172 1.83e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111812
AA Change: T98A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107443
Gene: ENSMUSG00000042671
AA Change: T98A

DomainStartEndE-ValueType
RGS 56 172 1.83e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111814
AA Change: T96A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107445
Gene: ENSMUSG00000042671
AA Change: T96A

DomainStartEndE-ValueType
RGS 54 170 1.83e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111815
AA Change: T96A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107446
Gene: ENSMUSG00000042671
AA Change: T96A

DomainStartEndE-ValueType
RGS 54 170 1.83e-53 SMART
Predicted Effect probably null
Transcript: ENSMUST00000124500
AA Change: T98A

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122518
Gene: ENSMUSG00000042671
AA Change: T98A

DomainStartEndE-ValueType
Pfam:RGS 56 99 2.3e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147482
AA Change: T96A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118365
Gene: ENSMUSG00000042671
AA Change: T96A

DomainStartEndE-ValueType
Pfam:RGS 54 115 6.5e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147700
AA Change: T98A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123565
Gene: ENSMUSG00000042671
AA Change: T98A

DomainStartEndE-ValueType
Pfam:RGS 56 115 1.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152114
AA Change: T98A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121910
Gene: ENSMUSG00000042671
AA Change: T98A

DomainStartEndE-ValueType
RGS 56 137 1.52e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187154
Meta Mutation Damage Score 0.176 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulator of G protein signaling (RGS) family and encodes a protein with a single RGS domain. Regulator of G protein signaling (RGS) proteins are regulatory and structural components of G protein-coupled receptor complexes. They accelerate transit through the cycle of GTP binding and hydrolysis to GDP, thereby terminating signal transduction, but paradoxically, also accelerate receptor-stimulated activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal fertility and Purkinje cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,407 E1119G probably damaging Het
5730559C18Rik A C 1: 136,214,372 V663G probably benign Het
Ahnak2 A G 12: 112,786,222 I132T probably damaging Het
Arhgap29 G A 3: 121,988,527 D63N possibly damaging Het
Bsn T A 9: 108,117,561 probably null Het
Cfap161 A C 7: 83,780,182 Y209* probably null Het
Drp2 A C X: 134,439,968 D458A probably benign Het
Efcab6 T C 15: 83,950,069 H446R probably benign Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
F13a1 G A 13: 36,943,993 T337I probably damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Hcfc1 A T X: 73,950,088 V1157D probably benign Het
Ino80 T C 2: 119,446,872 D374G probably null Het
Kif1a T C 1: 93,077,043 E143G probably null Het
Larp1 A T 11: 58,057,346 E990D probably benign Het
Larp7 C A 3: 127,536,965 E568* probably null Het
Ltn1 A T 16: 87,420,899 S298R probably damaging Het
Mcm10 A G 2: 4,997,102 probably null Het
Mef2a G A 7: 67,268,327 S111L probably benign Het
Mroh1 A G 15: 76,452,346 T1590A possibly damaging Het
Ncoa6 A T 2: 155,407,789 H1198Q possibly damaging Het
Ogg1 A G 6: 113,328,373 E49G probably damaging Het
Palm3 T A 8: 84,029,344 V495E probably benign Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Parp3 T C 9: 106,475,063 E88G possibly damaging Het
Ptprs A G 17: 56,428,965 I156T probably benign Het
Pus7l T A 15: 94,527,907 I538F probably damaging Het
Ryr2 C T 13: 11,772,580 probably null Het
Slc8a2 A G 7: 16,152,899 N656D possibly damaging Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tbcel T C 9: 42,461,295 probably benign Het
Trpv3 A T 11: 73,295,455 I691F probably damaging Het
Uba2 A G 7: 34,154,482 probably null Het
Usp53 A C 3: 122,934,412 S840R probably benign Het
Vmn2r100 A T 17: 19,523,430 I452F probably benign Het
Zbtb48 A T 4: 152,026,027 probably null Het
Zfp385b G A 2: 77,415,889 P177S probably benign Het
Zfp42 T C 8: 43,295,901 R188G possibly damaging Het
Other mutations in Rgs8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02100:Rgs8 APN 1 153692723 critical splice acceptor site probably null
IGL02163:Rgs8 APN 1 153671765 missense possibly damaging 0.71
IGL02826:Rgs8 APN 1 153670799 missense probably damaging 1.00
IGL03345:Rgs8 APN 1 153692810 missense probably benign 0.34
R0561:Rgs8 UTSW 1 153665922 splice site probably null
R0801:Rgs8 UTSW 1 153670811 missense probably damaging 1.00
R4058:Rgs8 UTSW 1 153690996 missense probably null 0.35
R4059:Rgs8 UTSW 1 153690996 missense probably null 0.35
R4877:Rgs8 UTSW 1 153692887 unclassified probably benign
R5070:Rgs8 UTSW 1 153665904 missense probably damaging 0.97
R5841:Rgs8 UTSW 1 153692828 missense probably damaging 1.00
R6028:Rgs8 UTSW 1 153690988 missense probably damaging 1.00
R6413:Rgs8 UTSW 1 153692873 missense probably damaging 1.00
X0028:Rgs8 UTSW 1 153670846 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAGGCTTGACTAGTCAGGATG -3'
(R):5'- GCCTTTCTCATCAGGATCCAAC -3'

Sequencing Primer
(F):5'- CAGGATGCTGACAAATTGGTATTG -3'
(R):5'- CTCAACAGAGTTAGGAGGCCC -3'
Posted On2015-02-19