Incidental Mutation 'R3618:Zfp385b'
ID268499
Institutional Source Beutler Lab
Gene Symbol Zfp385b
Ensembl Gene ENSMUSG00000027016
Gene Namezinc finger protein 385B
SynonymsC130013B13Rik, Zfp533, B830010L13Rik
MMRRC Submission 040675-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.395) question?
Stock #R3618 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location77410634-77819639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77415889 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 177 (P177S)
Ref Sequence ENSEMBL: ENSMUSP00000126801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090766] [ENSMUST00000111830] [ENSMUST00000111831] [ENSMUST00000171063]
Predicted Effect probably benign
Transcript: ENSMUST00000090766
AA Change: P265S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088271
Gene: ENSMUSG00000027016
AA Change: P265S

DomainStartEndE-ValueType
ZnF_U1 30 65 3.07e-4 SMART
ZnF_C2H2 34 58 3.21e1 SMART
low complexity region 66 81 N/A INTRINSIC
low complexity region 83 92 N/A INTRINSIC
ZnF_U1 166 200 9.3e-4 SMART
ZnF_C2H2 169 193 5.07e0 SMART
low complexity region 245 256 N/A INTRINSIC
ZnF_U1 294 328 2.29e-3 SMART
ZnF_C2H2 297 321 1.47e1 SMART
ZnF_U1 357 391 8.09e-4 SMART
ZnF_C2H2 360 384 6.57e-1 SMART
low complexity region 429 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111830
AA Change: P151S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107461
Gene: ENSMUSG00000027016
AA Change: P151S

DomainStartEndE-ValueType
ZnF_U1 52 86 9.3e-4 SMART
ZnF_C2H2 55 79 5.07e0 SMART
low complexity region 131 142 N/A INTRINSIC
ZnF_U1 180 214 2.29e-3 SMART
ZnF_C2H2 183 207 1.47e1 SMART
ZnF_U1 243 277 8.09e-4 SMART
ZnF_C2H2 246 270 6.57e-1 SMART
low complexity region 315 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111831
AA Change: P265S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107462
Gene: ENSMUSG00000027016
AA Change: P265S

DomainStartEndE-ValueType
ZnF_U1 30 65 3.07e-4 SMART
ZnF_C2H2 34 58 3.21e1 SMART
low complexity region 66 81 N/A INTRINSIC
low complexity region 83 92 N/A INTRINSIC
ZnF_U1 166 200 9.3e-4 SMART
ZnF_C2H2 169 193 5.07e0 SMART
low complexity region 245 256 N/A INTRINSIC
ZnF_U1 294 328 2.29e-3 SMART
ZnF_C2H2 297 321 1.47e1 SMART
ZnF_U1 357 391 8.09e-4 SMART
ZnF_C2H2 360 384 6.57e-1 SMART
low complexity region 429 452 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145251
Predicted Effect probably benign
Transcript: ENSMUST00000171063
AA Change: P177S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126801
Gene: ENSMUSG00000027016
AA Change: P177S

DomainStartEndE-ValueType
ZnF_U1 78 112 9.3e-4 SMART
ZnF_C2H2 81 105 5.07e0 SMART
low complexity region 157 168 N/A INTRINSIC
ZnF_U1 206 240 2.29e-3 SMART
ZnF_C2H2 209 233 1.47e1 SMART
ZnF_U1 269 303 8.09e-4 SMART
ZnF_C2H2 272 296 6.57e-1 SMART
low complexity region 341 364 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,407 E1119G probably damaging Het
5730559C18Rik A C 1: 136,214,372 V663G probably benign Het
Ahnak2 A G 12: 112,786,222 I132T probably damaging Het
Arhgap29 G A 3: 121,988,527 D63N possibly damaging Het
Bsn T A 9: 108,117,561 probably null Het
Cfap161 A C 7: 83,780,182 Y209* probably null Het
Drp2 A C X: 134,439,968 D458A probably benign Het
Efcab6 T C 15: 83,950,069 H446R probably benign Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
F13a1 G A 13: 36,943,993 T337I probably damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Hcfc1 A T X: 73,950,088 V1157D probably benign Het
Ino80 T C 2: 119,446,872 D374G probably null Het
Kif1a T C 1: 93,077,043 E143G probably null Het
Larp1 A T 11: 58,057,346 E990D probably benign Het
Larp7 C A 3: 127,536,965 E568* probably null Het
Ltn1 A T 16: 87,420,899 S298R probably damaging Het
Mcm10 A G 2: 4,997,102 probably null Het
Mef2a G A 7: 67,268,327 S111L probably benign Het
Mroh1 A G 15: 76,452,346 T1590A possibly damaging Het
Ncoa6 A T 2: 155,407,789 H1198Q possibly damaging Het
Ogg1 A G 6: 113,328,373 E49G probably damaging Het
Palm3 T A 8: 84,029,344 V495E probably benign Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Parp3 T C 9: 106,475,063 E88G possibly damaging Het
Ptprs A G 17: 56,428,965 I156T probably benign Het
Pus7l T A 15: 94,527,907 I538F probably damaging Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Ryr2 C T 13: 11,772,580 probably null Het
Slc8a2 A G 7: 16,152,899 N656D possibly damaging Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tbcel T C 9: 42,461,295 probably benign Het
Trpv3 A T 11: 73,295,455 I691F probably damaging Het
Uba2 A G 7: 34,154,482 probably null Het
Usp53 A C 3: 122,934,412 S840R probably benign Het
Vmn2r100 A T 17: 19,523,430 I452F probably benign Het
Zbtb48 A T 4: 152,026,027 probably null Het
Zfp42 T C 8: 43,295,901 R188G possibly damaging Het
Other mutations in Zfp385b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Zfp385b APN 2 77476778 missense probably damaging 1.00
IGL01684:Zfp385b APN 2 77719675 missense possibly damaging 0.86
IGL02354:Zfp385b APN 2 77450303 missense probably damaging 1.00
IGL02361:Zfp385b APN 2 77450303 missense probably damaging 1.00
IGL02939:Zfp385b APN 2 77412059 missense probably benign 0.00
R0008:Zfp385b UTSW 2 77415947 missense probably benign 0.27
R0008:Zfp385b UTSW 2 77415947 missense probably benign 0.27
R0243:Zfp385b UTSW 2 77415728 critical splice donor site probably null
R0403:Zfp385b UTSW 2 77476845 missense probably damaging 0.97
R1566:Zfp385b UTSW 2 77415913 missense probably benign 0.05
R1799:Zfp385b UTSW 2 77415972 missense probably benign 0.13
R3619:Zfp385b UTSW 2 77415889 missense probably benign
R4007:Zfp385b UTSW 2 77719492 missense probably benign 0.00
R6290:Zfp385b UTSW 2 77450268 missense possibly damaging 0.90
R6298:Zfp385b UTSW 2 77413979 missense possibly damaging 0.83
R6383:Zfp385b UTSW 2 77415841 missense probably benign 0.01
R6482:Zfp385b UTSW 2 77719648 small insertion probably benign
R6484:Zfp385b UTSW 2 77719648 small insertion probably benign
R6856:Zfp385b UTSW 2 77415794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAAGATGGCAGCTGACC -3'
(R):5'- AGCTCTGCAAGATAAAATCTGTGC -3'

Sequencing Primer
(F):5'- ACCTGTGTTGTGAGCCTCCAG -3'
(R):5'- CTGCAAGATAAAATCTGTGCTAAAC -3'
Posted On2015-02-19