Incidental Mutation 'R3618:Ncoa6'
ID268503
Institutional Source Beutler Lab
Gene Symbol Ncoa6
Ensembl Gene ENSMUSG00000038369
Gene Namenuclear receptor coactivator 6
SynonymsPRIP, ASC-2, NRC, AIB3, RAP250, ASC2
MMRRC Submission 040675-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3618 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location155390656-155473894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 155407789 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1198 (H1198Q)
Ref Sequence ENSEMBL: ENSMUSP00000118113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043126] [ENSMUST00000109670] [ENSMUST00000123293]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043126
AA Change: H1198Q

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045386
Gene: ENSMUSG00000038369
AA Change: H1198Q

DomainStartEndE-ValueType
Pfam:Nucleic_acid_bd 47 190 3.3e-55 PFAM
coiled coil region 256 296 N/A INTRINSIC
low complexity region 375 383 N/A INTRINSIC
internal_repeat_1 450 597 3.31e-5 PROSPERO
low complexity region 615 630 N/A INTRINSIC
internal_repeat_1 636 793 3.31e-5 PROSPERO
low complexity region 844 860 N/A INTRINSIC
low complexity region 909 931 N/A INTRINSIC
low complexity region 986 998 N/A INTRINSIC
low complexity region 1002 1046 N/A INTRINSIC
low complexity region 1126 1139 N/A INTRINSIC
low complexity region 1258 1273 N/A INTRINSIC
low complexity region 1328 1351 N/A INTRINSIC
low complexity region 1543 1564 N/A INTRINSIC
low complexity region 1578 1599 N/A INTRINSIC
low complexity region 1607 1618 N/A INTRINSIC
low complexity region 1808 1825 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 2043 2053 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109670
AA Change: H1198Q

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105295
Gene: ENSMUSG00000038369
AA Change: H1198Q

DomainStartEndE-ValueType
Pfam:Nucleic_acid_bd 45 195 3.6e-60 PFAM
coiled coil region 256 296 N/A INTRINSIC
low complexity region 375 383 N/A INTRINSIC
internal_repeat_1 450 597 3.31e-5 PROSPERO
low complexity region 615 630 N/A INTRINSIC
internal_repeat_1 636 793 3.31e-5 PROSPERO
low complexity region 844 860 N/A INTRINSIC
low complexity region 909 931 N/A INTRINSIC
low complexity region 986 998 N/A INTRINSIC
low complexity region 1002 1046 N/A INTRINSIC
low complexity region 1126 1139 N/A INTRINSIC
low complexity region 1258 1273 N/A INTRINSIC
low complexity region 1328 1351 N/A INTRINSIC
low complexity region 1543 1564 N/A INTRINSIC
low complexity region 1578 1599 N/A INTRINSIC
low complexity region 1607 1618 N/A INTRINSIC
low complexity region 1808 1825 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 2043 2053 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123293
AA Change: H1198Q

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118113
Gene: ENSMUSG00000038369
AA Change: H1198Q

DomainStartEndE-ValueType
Pfam:Nucleic_acid_bd 45 195 2.4e-60 PFAM
coiled coil region 256 296 N/A INTRINSIC
low complexity region 375 383 N/A INTRINSIC
low complexity region 564 573 N/A INTRINSIC
low complexity region 615 630 N/A INTRINSIC
low complexity region 844 860 N/A INTRINSIC
low complexity region 909 931 N/A INTRINSIC
low complexity region 986 998 N/A INTRINSIC
low complexity region 1002 1046 N/A INTRINSIC
low complexity region 1126 1139 N/A INTRINSIC
low complexity region 1258 1273 N/A INTRINSIC
low complexity region 1328 1351 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146942
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit retarded embryonic growth and defects of the placenta, heart, liver, and nervous system. Mutants die around midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,407 E1119G probably damaging Het
5730559C18Rik A C 1: 136,214,372 V663G probably benign Het
Ahnak2 A G 12: 112,786,222 I132T probably damaging Het
Arhgap29 G A 3: 121,988,527 D63N possibly damaging Het
Bsn T A 9: 108,117,561 probably null Het
Cfap161 A C 7: 83,780,182 Y209* probably null Het
Drp2 A C X: 134,439,968 D458A probably benign Het
Efcab6 T C 15: 83,950,069 H446R probably benign Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
F13a1 G A 13: 36,943,993 T337I probably damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Hcfc1 A T X: 73,950,088 V1157D probably benign Het
Ino80 T C 2: 119,446,872 D374G probably null Het
Kif1a T C 1: 93,077,043 E143G probably null Het
Larp1 A T 11: 58,057,346 E990D probably benign Het
Larp7 C A 3: 127,536,965 E568* probably null Het
Ltn1 A T 16: 87,420,899 S298R probably damaging Het
Mcm10 A G 2: 4,997,102 probably null Het
Mef2a G A 7: 67,268,327 S111L probably benign Het
Mroh1 A G 15: 76,452,346 T1590A possibly damaging Het
Ogg1 A G 6: 113,328,373 E49G probably damaging Het
Palm3 T A 8: 84,029,344 V495E probably benign Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Parp3 T C 9: 106,475,063 E88G possibly damaging Het
Ptprs A G 17: 56,428,965 I156T probably benign Het
Pus7l T A 15: 94,527,907 I538F probably damaging Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Ryr2 C T 13: 11,772,580 probably null Het
Slc8a2 A G 7: 16,152,899 N656D possibly damaging Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tbcel T C 9: 42,461,295 probably benign Het
Trpv3 A T 11: 73,295,455 I691F probably damaging Het
Uba2 A G 7: 34,154,482 probably null Het
Usp53 A C 3: 122,934,412 S840R probably benign Het
Vmn2r100 A T 17: 19,523,430 I452F probably benign Het
Zbtb48 A T 4: 152,026,027 probably null Het
Zfp385b G A 2: 77,415,889 P177S probably benign Het
Zfp42 T C 8: 43,295,901 R188G possibly damaging Het
Other mutations in Ncoa6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Ncoa6 APN 2 155406208 missense probably damaging 0.99
IGL00849:Ncoa6 APN 2 155421688 missense possibly damaging 0.89
IGL00933:Ncoa6 APN 2 155415397 missense probably damaging 1.00
IGL00981:Ncoa6 APN 2 155406179 missense probably damaging 0.98
IGL01420:Ncoa6 APN 2 155407587 missense probably damaging 1.00
IGL02160:Ncoa6 APN 2 155421083 missense possibly damaging 0.65
IGL03049:Ncoa6 APN 2 155419014 missense probably damaging 1.00
IGL03194:Ncoa6 APN 2 155415868 missense possibly damaging 0.94
IGL03269:Ncoa6 APN 2 155406489 missense probably damaging 0.97
IGL03299:Ncoa6 APN 2 155407287 missense probably damaging 0.97
IGL03306:Ncoa6 APN 2 155405507 missense probably benign 0.30
alcoa UTSW 2 155402664 unclassified probably benign
Aluminum UTSW 2 155399693 critical splice acceptor site probably null
balboa UTSW 2 155406949 missense probably benign 0.05
PIT4466001:Ncoa6 UTSW 2 155405657 missense probably benign
R0011:Ncoa6 UTSW 2 155408291 frame shift probably null
R0014:Ncoa6 UTSW 2 155438043 missense possibly damaging 0.86
R0079:Ncoa6 UTSW 2 155408291 frame shift probably null
R0080:Ncoa6 UTSW 2 155408291 frame shift probably null
R0081:Ncoa6 UTSW 2 155408291 frame shift probably null
R0164:Ncoa6 UTSW 2 155408291 frame shift probably null
R0166:Ncoa6 UTSW 2 155408291 frame shift probably null
R0172:Ncoa6 UTSW 2 155408291 frame shift probably null
R0173:Ncoa6 UTSW 2 155408291 frame shift probably null
R0245:Ncoa6 UTSW 2 155391211 missense probably benign 0.00
R0284:Ncoa6 UTSW 2 155408291 frame shift probably null
R0285:Ncoa6 UTSW 2 155408291 frame shift probably null
R0285:Ncoa6 UTSW 2 155415701 missense probably damaging 0.96
R0288:Ncoa6 UTSW 2 155408291 frame shift probably null
R0539:Ncoa6 UTSW 2 155415697 missense probably benign 0.08
R0652:Ncoa6 UTSW 2 155391211 missense probably benign 0.00
R0781:Ncoa6 UTSW 2 155411520 splice site probably benign
R1053:Ncoa6 UTSW 2 155434040 missense probably damaging 1.00
R1110:Ncoa6 UTSW 2 155411520 splice site probably benign
R1420:Ncoa6 UTSW 2 155421153 nonsense probably null
R1521:Ncoa6 UTSW 2 155415222 missense possibly damaging 0.78
R1541:Ncoa6 UTSW 2 155415304 missense probably benign 0.35
R1677:Ncoa6 UTSW 2 155402664 unclassified probably benign
R1858:Ncoa6 UTSW 2 155421639 missense probably benign 0.13
R1954:Ncoa6 UTSW 2 155406821 missense possibly damaging 0.94
R1955:Ncoa6 UTSW 2 155406821 missense possibly damaging 0.94
R2040:Ncoa6 UTSW 2 155406080 missense probably damaging 0.98
R2087:Ncoa6 UTSW 2 155406159 nonsense probably null
R2159:Ncoa6 UTSW 2 155407713 missense probably damaging 1.00
R2278:Ncoa6 UTSW 2 155407650 missense possibly damaging 0.94
R2696:Ncoa6 UTSW 2 155438015 missense probably benign 0.45
R2891:Ncoa6 UTSW 2 155437961 missense possibly damaging 0.86
R3747:Ncoa6 UTSW 2 155411641 missense probably benign 0.01
R3778:Ncoa6 UTSW 2 155421195 missense probably damaging 1.00
R3784:Ncoa6 UTSW 2 155407757 missense probably damaging 1.00
R3802:Ncoa6 UTSW 2 155405564 missense probably benign
R3820:Ncoa6 UTSW 2 155406938 missense probably damaging 1.00
R3821:Ncoa6 UTSW 2 155406938 missense probably damaging 1.00
R3822:Ncoa6 UTSW 2 155406938 missense probably damaging 1.00
R3870:Ncoa6 UTSW 2 155415557 unclassified probably null
R4037:Ncoa6 UTSW 2 155407370 missense probably damaging 0.98
R4488:Ncoa6 UTSW 2 155407476 missense possibly damaging 0.94
R4719:Ncoa6 UTSW 2 155391161 unclassified probably benign
R4732:Ncoa6 UTSW 2 155421301 missense probably damaging 1.00
R4733:Ncoa6 UTSW 2 155421301 missense probably damaging 1.00
R4829:Ncoa6 UTSW 2 155415227 missense probably damaging 0.99
R4835:Ncoa6 UTSW 2 155407133 missense possibly damaging 0.46
R4883:Ncoa6 UTSW 2 155406767 missense probably benign 0.29
R4967:Ncoa6 UTSW 2 155421332 missense possibly damaging 0.80
R5021:Ncoa6 UTSW 2 155406949 missense probably benign 0.05
R5234:Ncoa6 UTSW 2 155438013 missense probably benign 0.01
R5356:Ncoa6 UTSW 2 155421192 missense probably damaging 0.99
R5358:Ncoa6 UTSW 2 155406987 missense probably damaging 0.97
R5375:Ncoa6 UTSW 2 155433995 missense probably benign 0.16
R5412:Ncoa6 UTSW 2 155407781 missense possibly damaging 0.95
R5579:Ncoa6 UTSW 2 155406677 missense probably damaging 1.00
R5618:Ncoa6 UTSW 2 155437897 missense possibly damaging 0.86
R5641:Ncoa6 UTSW 2 155421836 missense probably benign 0.22
R5757:Ncoa6 UTSW 2 155411608 missense probably damaging 1.00
R5761:Ncoa6 UTSW 2 155408141 missense probably benign 0.11
R5778:Ncoa6 UTSW 2 155406768 missense probably benign 0.01
R5852:Ncoa6 UTSW 2 155405499 missense possibly damaging 0.88
R5940:Ncoa6 UTSW 2 155415865 missense probably damaging 0.98
R6155:Ncoa6 UTSW 2 155407448 missense probably damaging 1.00
R6374:Ncoa6 UTSW 2 155421156 missense probably damaging 1.00
R6389:Ncoa6 UTSW 2 155395816 missense probably damaging 0.98
R6669:Ncoa6 UTSW 2 155399693 critical splice acceptor site probably null
R7097:Ncoa6 UTSW 2 155438063 missense probably benign 0.01
X0017:Ncoa6 UTSW 2 155406540 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATTTGGCCTGGGAGGTAAAG -3'
(R):5'- TCCTGAAGCTAGTGGCAGTG -3'

Sequencing Primer
(F):5'- TATTAATCTGTGGAGGGAAGAGTCC -3'
(R):5'- CAGTGAAGTACCATCTGTTGCAG -3'
Posted On2015-02-19