Incidental Mutation 'R3618:Enpep'
ID268509
Institutional Source Beutler Lab
Gene Symbol Enpep
Ensembl Gene ENSMUSG00000028024
Gene Nameglutamyl aminopeptidase
SynonymsLy51, aminopeptidase-A, Bp-1/6C3, 6030431M22Rik, APA, Ly-51
MMRRC Submission 040675-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3618 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location129269175-129332720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 129284158 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 603 (S603R)
Ref Sequence ENSEMBL: ENSMUSP00000029658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029658]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029658
AA Change: S603R

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029658
Gene: ENSMUSG00000028024
AA Change: S603R

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:Peptidase_M1 84 474 6e-147 PFAM
Pfam:ERAP1_C 607 925 1e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164443
Predicted Effect unknown
Transcript: ENSMUST00000169240
AA Change: S179R
SMART Domains Protein: ENSMUSP00000129759
Gene: ENSMUSG00000028024
AA Change: S179R

DomainStartEndE-ValueType
Pfam:Peptidase_M1 1 51 1.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170918
SMART Domains Protein: ENSMUSP00000128872
Gene: ENSMUSG00000028024

DomainStartEndE-ValueType
Pfam:Peptidase_M1 12 402 9.6e-148 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198498
Meta Mutation Damage Score 0.0976 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and morphologically unaffected with normal B and T cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,407 E1119G probably damaging Het
5730559C18Rik A C 1: 136,214,372 V663G probably benign Het
Ahnak2 A G 12: 112,786,222 I132T probably damaging Het
Arhgap29 G A 3: 121,988,527 D63N possibly damaging Het
Bsn T A 9: 108,117,561 probably null Het
Cfap161 A C 7: 83,780,182 Y209* probably null Het
Drp2 A C X: 134,439,968 D458A probably benign Het
Efcab6 T C 15: 83,950,069 H446R probably benign Het
F13a1 G A 13: 36,943,993 T337I probably damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Hcfc1 A T X: 73,950,088 V1157D probably benign Het
Ino80 T C 2: 119,446,872 D374G probably null Het
Kif1a T C 1: 93,077,043 E143G probably null Het
Larp1 A T 11: 58,057,346 E990D probably benign Het
Larp7 C A 3: 127,536,965 E568* probably null Het
Ltn1 A T 16: 87,420,899 S298R probably damaging Het
Mcm10 A G 2: 4,997,102 probably null Het
Mef2a G A 7: 67,268,327 S111L probably benign Het
Mroh1 A G 15: 76,452,346 T1590A possibly damaging Het
Ncoa6 A T 2: 155,407,789 H1198Q possibly damaging Het
Ogg1 A G 6: 113,328,373 E49G probably damaging Het
Palm3 T A 8: 84,029,344 V495E probably benign Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Parp3 T C 9: 106,475,063 E88G possibly damaging Het
Ptprs A G 17: 56,428,965 I156T probably benign Het
Pus7l T A 15: 94,527,907 I538F probably damaging Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Ryr2 C T 13: 11,772,580 probably null Het
Slc8a2 A G 7: 16,152,899 N656D possibly damaging Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tbcel T C 9: 42,461,295 probably benign Het
Trpv3 A T 11: 73,295,455 I691F probably damaging Het
Uba2 A G 7: 34,154,482 probably null Het
Usp53 A C 3: 122,934,412 S840R probably benign Het
Vmn2r100 A T 17: 19,523,430 I452F probably benign Het
Zbtb48 A T 4: 152,026,027 probably null Het
Zfp385b G A 2: 77,415,889 P177S probably benign Het
Zfp42 T C 8: 43,295,901 R188G possibly damaging Het
Other mutations in Enpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Enpep APN 3 129332082 missense possibly damaging 0.69
IGL01895:Enpep APN 3 129270334 missense possibly damaging 0.89
IGL02193:Enpep APN 3 129281687 missense possibly damaging 0.46
IGL02215:Enpep APN 3 129270277 splice site probably benign
IGL02511:Enpep APN 3 129321410 missense probably damaging 1.00
IGL02579:Enpep APN 3 129284090 missense probably benign 0.07
IGL02634:Enpep APN 3 129309857 missense probably damaging 1.00
IGL03034:Enpep APN 3 129298950 missense probably damaging 0.99
IGL03214:Enpep APN 3 129293247 missense probably benign
IGL03401:Enpep APN 3 129312620 missense probably benign 0.01
P0041:Enpep UTSW 3 129332198 missense possibly damaging 0.80
R0371:Enpep UTSW 3 129283867 critical splice donor site probably null
R0479:Enpep UTSW 3 129312674 missense possibly damaging 0.65
R1036:Enpep UTSW 3 129284109 missense probably damaging 0.99
R1466:Enpep UTSW 3 129319448 missense probably damaging 1.00
R1466:Enpep UTSW 3 129319448 missense probably damaging 1.00
R1584:Enpep UTSW 3 129319448 missense probably damaging 1.00
R2060:Enpep UTSW 3 129280523 missense probably benign 0.14
R2101:Enpep UTSW 3 129298938 missense probably benign 0.00
R2153:Enpep UTSW 3 129280582 missense probably damaging 0.99
R2474:Enpep UTSW 3 129284158 missense possibly damaging 0.77
R3619:Enpep UTSW 3 129284158 missense possibly damaging 0.77
R4275:Enpep UTSW 3 129332278 missense probably benign 0.02
R4291:Enpep UTSW 3 129270317 nonsense probably null
R4438:Enpep UTSW 3 129284091 missense possibly damaging 0.94
R4570:Enpep UTSW 3 129281548 missense possibly damaging 0.67
R4678:Enpep UTSW 3 129303713 critical splice donor site probably null
R4679:Enpep UTSW 3 129303713 critical splice donor site probably null
R4748:Enpep UTSW 3 129332163 missense probably damaging 1.00
R4878:Enpep UTSW 3 129276771 missense probably benign 0.17
R4954:Enpep UTSW 3 129284180 missense probably damaging 0.98
R5074:Enpep UTSW 3 129303755 missense probably damaging 1.00
R5261:Enpep UTSW 3 129305426 missense probably damaging 1.00
R5328:Enpep UTSW 3 129280510 missense probably benign 0.30
R5661:Enpep UTSW 3 129276757 missense probably damaging 0.98
R5687:Enpep UTSW 3 129299094 splice site probably null
R5695:Enpep UTSW 3 129309099 missense probably damaging 1.00
R5697:Enpep UTSW 3 129309123 missense probably benign
R5889:Enpep UTSW 3 129312578 missense probably damaging 1.00
R5940:Enpep UTSW 3 129312578 missense probably damaging 1.00
R5968:Enpep UTSW 3 129280938 missense probably benign
R5976:Enpep UTSW 3 129299124 missense probably damaging 0.97
R6151:Enpep UTSW 3 129332418 missense possibly damaging 0.82
R6367:Enpep UTSW 3 129332081 missense possibly damaging 0.94
R6468:Enpep UTSW 3 129331860 critical splice donor site probably null
R6484:Enpep UTSW 3 129321481 missense probably damaging 0.96
R6938:Enpep UTSW 3 129298950 missense probably damaging 0.99
R6989:Enpep UTSW 3 129280950 missense probably damaging 1.00
R7073:Enpep UTSW 3 129312670 nonsense probably null
R7258:Enpep UTSW 3 129332075 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAACAGGGACGCCATGATTCTC -3'
(R):5'- CTTAGAGGCTCTGGGTCTAAATC -3'

Sequencing Primer
(F):5'- GGGACGCCATGATTCTCAAAGC -3'
(R):5'- GAGGCTCTGGGTCTAAATCAAACTTG -3'
Posted On2015-02-19