Incidental Mutation 'R3618:Zbtb48'
ID268512
Institutional Source Beutler Lab
Gene Symbol Zbtb48
Ensembl Gene ENSMUSG00000028952
Gene Namezinc finger and BTB domain containing 48
Synonyms0610011D15Rik, Hkr3
MMRRC Submission 040675-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3618 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location152019774-152027671 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 152026027 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000067521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030792] [ENSMUST00000066715] [ENSMUST00000131935] [ENSMUST00000155389] [ENSMUST00000156748]
PDB Structure
Solution structure of the tandem four zf-C2H2 domain repeats of murine GLI-Kruppel family member HKR3 [SOLUTION NMR]
Crystal structure of BTB domain from mouse HKR3 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000030792
SMART Domains Protein: ENSMUSP00000030792
Gene: ENSMUSG00000028950

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 456 1.7e-69 PFAM
Pfam:NCD3G 494 546 2.1e-15 PFAM
Pfam:7tm_3 578 815 3.9e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000066715
SMART Domains Protein: ENSMUSP00000067521
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
ZnF_C2H2 284 306 1.64e-1 SMART
ZnF_C2H2 312 332 2.06e1 SMART
ZnF_C2H2 343 365 5.99e-4 SMART
ZnF_C2H2 371 394 9.58e-3 SMART
ZnF_C2H2 400 423 2.49e-1 SMART
ZnF_C2H2 429 452 2.57e-3 SMART
ZnF_C2H2 458 480 9.73e-4 SMART
ZnF_C2H2 486 508 3.21e-4 SMART
ZnF_C2H2 514 537 1.67e-2 SMART
ZnF_C2H2 543 565 1.95e-3 SMART
ZnF_C2H2 571 593 5.67e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123696
Predicted Effect probably benign
Transcript: ENSMUST00000131935
SMART Domains Protein: ENSMUSP00000116423
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147895
Predicted Effect probably benign
Transcript: ENSMUST00000155389
SMART Domains Protein: ENSMUSP00000114726
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
ZnF_C2H2 284 306 1.64e-1 SMART
ZnF_C2H2 312 332 2.06e1 SMART
ZnF_C2H2 343 365 5.99e-4 SMART
ZnF_C2H2 371 394 9.58e-3 SMART
low complexity region 403 418 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155441
Predicted Effect probably benign
Transcript: ENSMUST00000156748
SMART Domains Protein: ENSMUSP00000117079
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
ZnF_C2H2 80 102 1.64e-1 SMART
ZnF_C2H2 108 128 2.06e1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,407 E1119G probably damaging Het
5730559C18Rik A C 1: 136,214,372 V663G probably benign Het
Ahnak2 A G 12: 112,786,222 I132T probably damaging Het
Arhgap29 G A 3: 121,988,527 D63N possibly damaging Het
Bsn T A 9: 108,117,561 probably null Het
Cfap161 A C 7: 83,780,182 Y209* probably null Het
Drp2 A C X: 134,439,968 D458A probably benign Het
Efcab6 T C 15: 83,950,069 H446R probably benign Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
F13a1 G A 13: 36,943,993 T337I probably damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Hcfc1 A T X: 73,950,088 V1157D probably benign Het
Ino80 T C 2: 119,446,872 D374G probably null Het
Kif1a T C 1: 93,077,043 E143G probably null Het
Larp1 A T 11: 58,057,346 E990D probably benign Het
Larp7 C A 3: 127,536,965 E568* probably null Het
Ltn1 A T 16: 87,420,899 S298R probably damaging Het
Mcm10 A G 2: 4,997,102 probably null Het
Mef2a G A 7: 67,268,327 S111L probably benign Het
Mroh1 A G 15: 76,452,346 T1590A possibly damaging Het
Ncoa6 A T 2: 155,407,789 H1198Q possibly damaging Het
Ogg1 A G 6: 113,328,373 E49G probably damaging Het
Palm3 T A 8: 84,029,344 V495E probably benign Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Parp3 T C 9: 106,475,063 E88G possibly damaging Het
Ptprs A G 17: 56,428,965 I156T probably benign Het
Pus7l T A 15: 94,527,907 I538F probably damaging Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Ryr2 C T 13: 11,772,580 probably null Het
Slc8a2 A G 7: 16,152,899 N656D possibly damaging Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tbcel T C 9: 42,461,295 probably benign Het
Trpv3 A T 11: 73,295,455 I691F probably damaging Het
Uba2 A G 7: 34,154,482 probably null Het
Usp53 A C 3: 122,934,412 S840R probably benign Het
Vmn2r100 A T 17: 19,523,430 I452F probably benign Het
Zfp385b G A 2: 77,415,889 P177S probably benign Het
Zfp42 T C 8: 43,295,901 R188G possibly damaging Het
Other mutations in Zbtb48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Zbtb48 APN 4 152021394 missense probably damaging 0.99
IGL02709:Zbtb48 APN 4 152021394 missense probably damaging 0.99
Etna UTSW 4 152021607 missense probably damaging 0.98
I0000:Zbtb48 UTSW 4 152019858 missense probably benign 0.34
R1515:Zbtb48 UTSW 4 152020201 unclassified probably null
R1844:Zbtb48 UTSW 4 152026498 missense probably benign
R2383:Zbtb48 UTSW 4 152026950 missense probably damaging 0.96
R3619:Zbtb48 UTSW 4 152026027 splice site probably null
R5427:Zbtb48 UTSW 4 152020651 missense probably damaging 1.00
R5696:Zbtb48 UTSW 4 152020610 missense probably damaging 0.99
R6155:Zbtb48 UTSW 4 152022038 unclassified probably null
R6157:Zbtb48 UTSW 4 152021607 missense probably damaging 0.98
R6551:Zbtb48 UTSW 4 152022221 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATGTGGGACATTCGACCG -3'
(R):5'- CCTTAGGTTAGTGATCCTGGCC -3'

Sequencing Primer
(F):5'- GGAACGGCTGCACCTTTTCTG -3'
(R):5'- GTTAGTGATCCTGGCCAGCTC -3'
Posted On2015-02-19