Incidental Mutation 'R3618:Ogg1'
ID268514
Institutional Source Beutler Lab
Gene Symbol Ogg1
Ensembl Gene ENSMUSG00000030271
Gene Name8-oxoguanine DNA-glycosylase 1
SynonymsMmh
MMRRC Submission 040675-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R3618 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location113326972-113335068 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113328373 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 49 (E49G)
Ref Sequence ENSEMBL: ENSMUSP00000144905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032406] [ENSMUST00000113117] [ENSMUST00000113119] [ENSMUST00000113121] [ENSMUST00000113122] [ENSMUST00000136263] [ENSMUST00000203577] [ENSMUST00000204198] [ENSMUST00000204626] [ENSMUST00000204834]
Predicted Effect probably damaging
Transcript: ENSMUST00000032406
AA Change: E49G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032406
Gene: ENSMUSG00000030271
AA Change: E49G

DomainStartEndE-ValueType
Pfam:OGG_N 25 141 4e-38 PFAM
ENDO3c 146 316 4.84e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113117
SMART Domains Protein: ENSMUSP00000108742
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 1e-35 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 762 773 N/A INTRINSIC
low complexity region 855 869 N/A INTRINSIC
low complexity region 901 911 N/A INTRINSIC
low complexity region 940 964 N/A INTRINSIC
low complexity region 993 1019 N/A INTRINSIC
low complexity region 1078 1090 N/A INTRINSIC
PWWP 1115 1198 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113119
SMART Domains Protein: ENSMUSP00000108744
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 8.5e-39 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 941 965 N/A INTRINSIC
low complexity region 994 1020 N/A INTRINSIC
low complexity region 1079 1091 N/A INTRINSIC
PWWP 1116 1199 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113121
SMART Domains Protein: ENSMUSP00000108746
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 5.5e-36 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 902 912 N/A INTRINSIC
low complexity region 941 965 N/A INTRINSIC
low complexity region 994 1020 N/A INTRINSIC
PWWP 1082 1165 4.1e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113122
SMART Domains Protein: ENSMUSP00000108747
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 2.63e0 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 105 254 5.5e-36 PFAM
PHD 274 320 7.63e-10 SMART
PHD 384 447 1.05e-7 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1.58e-37 SMART
low complexity region 762 773 N/A INTRINSIC
low complexity region 855 869 N/A INTRINSIC
low complexity region 901 911 N/A INTRINSIC
low complexity region 940 964 N/A INTRINSIC
low complexity region 993 1019 N/A INTRINSIC
PWWP 1081 1164 4.1e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131594
Predicted Effect probably damaging
Transcript: ENSMUST00000136263
AA Change: E49G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144792
Gene: ENSMUSG00000030271
AA Change: E49G

DomainStartEndE-ValueType
Pfam:OGG_N 25 130 3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147945
SMART Domains Protein: ENSMUSP00000116265
Gene: ENSMUSG00000030271

DomainStartEndE-ValueType
Blast:ENDO3c 7 75 7e-46 BLAST
PDB:1KO9|A 7 104 1e-55 PDB
SCOP:d1ko9a1 8 82 1e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156734
Predicted Effect probably benign
Transcript: ENSMUST00000203577
SMART Domains Protein: ENSMUSP00000144820
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 5.1e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 739 1.3e-34 SMART
low complexity region 768 779 N/A INTRINSIC
low complexity region 861 875 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 946 970 N/A INTRINSIC
low complexity region 999 1025 N/A INTRINSIC
low complexity region 1084 1096 N/A INTRINSIC
PWWP 1121 1204 2.6e-44 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203721
Predicted Effect probably benign
Transcript: ENSMUST00000204198
SMART Domains Protein: ENSMUSP00000144804
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 4.4e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 733 1e-39 SMART
low complexity region 856 870 N/A INTRINSIC
low complexity region 899 925 N/A INTRINSIC
PWWP 987 1070 2.6e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204626
SMART Domains Protein: ENSMUSP00000145093
Gene: ENSMUSG00000001632

DomainStartEndE-ValueType
ZnF_C2H2 21 47 1.2e-2 SMART
low complexity region 74 85 N/A INTRINSIC
Pfam:EPL1 106 254 4.9e-36 PFAM
PHD 274 320 4.9e-12 SMART
PHD 384 447 6.8e-10 SMART
low complexity region 461 498 N/A INTRINSIC
BROMO 625 739 1.3e-34 SMART
low complexity region 768 779 N/A INTRINSIC
low complexity region 861 875 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 946 970 N/A INTRINSIC
low complexity region 999 1025 N/A INTRINSIC
PWWP 1087 1170 2.6e-44 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000204834
AA Change: E49G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144905
Gene: ENSMUSG00000030271
AA Change: E49G

DomainStartEndE-ValueType
Pfam:OGG_N 25 134 1.2e-27 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for the excision of 8-oxoguanine, a mutagenic base byproduct which occurs as a result of exposure to reactive oxygen. The action of this enzyme includes lyase activity for chain cleavage. Alternative splicing of the C-terminal region of this gene classifies splice variants into two major groups, type 1 and type 2, depending on the last exon of the sequence. Type 1 alternative splice variants end with exon 7 and type 2 end with exon 8. All variants share the N-terminal region in common, which contains a mitochondrial targeting signal that is essential for mitochondrial localization. Many alternative splice variants for this gene have been described, but the full-length nature for every variant has not been determined. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to accumulation of 8-hydroxyguanine and altered DNA repair. Mice homozygous for a knock-out allele remain healthy until at least 18 months of age. Mice homozygous for another knock-out allele develop spontaneouslung adenoma/carcinoma at ~1.5 years of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,407 E1119G probably damaging Het
5730559C18Rik A C 1: 136,214,372 V663G probably benign Het
Ahnak2 A G 12: 112,786,222 I132T probably damaging Het
Arhgap29 G A 3: 121,988,527 D63N possibly damaging Het
Bsn T A 9: 108,117,561 probably null Het
Cfap161 A C 7: 83,780,182 Y209* probably null Het
Drp2 A C X: 134,439,968 D458A probably benign Het
Efcab6 T C 15: 83,950,069 H446R probably benign Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
F13a1 G A 13: 36,943,993 T337I probably damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Hcfc1 A T X: 73,950,088 V1157D probably benign Het
Ino80 T C 2: 119,446,872 D374G probably null Het
Kif1a T C 1: 93,077,043 E143G probably null Het
Larp1 A T 11: 58,057,346 E990D probably benign Het
Larp7 C A 3: 127,536,965 E568* probably null Het
Ltn1 A T 16: 87,420,899 S298R probably damaging Het
Mcm10 A G 2: 4,997,102 probably null Het
Mef2a G A 7: 67,268,327 S111L probably benign Het
Mroh1 A G 15: 76,452,346 T1590A possibly damaging Het
Ncoa6 A T 2: 155,407,789 H1198Q possibly damaging Het
Palm3 T A 8: 84,029,344 V495E probably benign Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Parp3 T C 9: 106,475,063 E88G possibly damaging Het
Ptprs A G 17: 56,428,965 I156T probably benign Het
Pus7l T A 15: 94,527,907 I538F probably damaging Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Ryr2 C T 13: 11,772,580 probably null Het
Slc8a2 A G 7: 16,152,899 N656D possibly damaging Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tbcel T C 9: 42,461,295 probably benign Het
Trpv3 A T 11: 73,295,455 I691F probably damaging Het
Uba2 A G 7: 34,154,482 probably null Het
Usp53 A C 3: 122,934,412 S840R probably benign Het
Vmn2r100 A T 17: 19,523,430 I452F probably benign Het
Zbtb48 A T 4: 152,026,027 probably null Het
Zfp385b G A 2: 77,415,889 P177S probably benign Het
Zfp42 T C 8: 43,295,901 R188G possibly damaging Het
Other mutations in Ogg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03171:Ogg1 APN 6 113333414 missense possibly damaging 0.90
IGL03180:Ogg1 APN 6 113333494 critical splice donor site probably null
R0270:Ogg1 UTSW 6 113329256 missense probably benign 0.00
R0883:Ogg1 UTSW 6 113328420 missense probably damaging 1.00
R2107:Ogg1 UTSW 6 113329293 missense probably damaging 1.00
R3771:Ogg1 UTSW 6 113333843 missense possibly damaging 0.47
R4609:Ogg1 UTSW 6 113328432 missense probably damaging 0.99
R4673:Ogg1 UTSW 6 113327307 missense probably damaging 1.00
R5580:Ogg1 UTSW 6 113329376 missense probably damaging 1.00
R7028:Ogg1 UTSW 6 113329276 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGAGAAACCCTGTCTCG -3'
(R):5'- CTTTGGAAGTGGGAGTCTACAGAAG -3'

Sequencing Primer
(F):5'- CCTGTCTCGGGGAAAAAGAAAG -3'
(R):5'- TATACAGCTGTGCCAGGCTGAC -3'
Posted On2015-02-19