Incidental Mutation 'R3618:Slc8a2'
ID268515
Institutional Source Beutler Lab
Gene Symbol Slc8a2
Ensembl Gene ENSMUSG00000030376
Gene Namesolute carrier family 8 (sodium/calcium exchanger), member 2
SynonymsNcx2
MMRRC Submission 040675-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R3618 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location16129826-16161063 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16152899 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 656 (N656D)
Ref Sequence ENSEMBL: ENSMUSP00000147497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168693] [ENSMUST00000211649]
Predicted Effect probably benign
Transcript: ENSMUST00000168693
AA Change: N650D

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128926
Gene: ENSMUSG00000030376
AA Change: N650D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 23 32 N/A INTRINSIC
Pfam:Na_Ca_ex 74 245 8.6e-35 PFAM
Pfam:Na_Ca_ex_C 248 378 7.8e-50 PFAM
Calx_beta 383 483 3.27e-47 SMART
Calx_beta 512 612 3.37e-49 SMART
low complexity region 704 717 N/A INTRINSIC
Pfam:Na_Ca_ex 747 912 2.5e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211649
AA Change: N656D

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: The clearance of elevated calcium following depolarization is delayed in homozygous mutant mice, which exhibit enhanced learning and memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,407 E1119G probably damaging Het
5730559C18Rik A C 1: 136,214,372 V663G probably benign Het
Ahnak2 A G 12: 112,786,222 I132T probably damaging Het
Arhgap29 G A 3: 121,988,527 D63N possibly damaging Het
Bsn T A 9: 108,117,561 probably null Het
Cfap161 A C 7: 83,780,182 Y209* probably null Het
Drp2 A C X: 134,439,968 D458A probably benign Het
Efcab6 T C 15: 83,950,069 H446R probably benign Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
F13a1 G A 13: 36,943,993 T337I probably damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Hcfc1 A T X: 73,950,088 V1157D probably benign Het
Ino80 T C 2: 119,446,872 D374G probably null Het
Kif1a T C 1: 93,077,043 E143G probably null Het
Larp1 A T 11: 58,057,346 E990D probably benign Het
Larp7 C A 3: 127,536,965 E568* probably null Het
Ltn1 A T 16: 87,420,899 S298R probably damaging Het
Mcm10 A G 2: 4,997,102 probably null Het
Mef2a G A 7: 67,268,327 S111L probably benign Het
Mroh1 A G 15: 76,452,346 T1590A possibly damaging Het
Ncoa6 A T 2: 155,407,789 H1198Q possibly damaging Het
Ogg1 A G 6: 113,328,373 E49G probably damaging Het
Palm3 T A 8: 84,029,344 V495E probably benign Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Parp3 T C 9: 106,475,063 E88G possibly damaging Het
Ptprs A G 17: 56,428,965 I156T probably benign Het
Pus7l T A 15: 94,527,907 I538F probably damaging Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Ryr2 C T 13: 11,772,580 probably null Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tbcel T C 9: 42,461,295 probably benign Het
Trpv3 A T 11: 73,295,455 I691F probably damaging Het
Uba2 A G 7: 34,154,482 probably null Het
Usp53 A C 3: 122,934,412 S840R probably benign Het
Vmn2r100 A T 17: 19,523,430 I452F probably benign Het
Zbtb48 A T 4: 152,026,027 probably null Het
Zfp385b G A 2: 77,415,889 P177S probably benign Het
Zfp42 T C 8: 43,295,901 R188G possibly damaging Het
Other mutations in Slc8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Slc8a2 APN 7 16158893 missense probably damaging 1.00
IGL02097:Slc8a2 APN 7 16157156 missense possibly damaging 0.88
IGL02744:Slc8a2 APN 7 16145029 missense possibly damaging 0.91
PIT4402001:Slc8a2 UTSW 7 16134494 missense probably damaging 1.00
PIT4515001:Slc8a2 UTSW 7 16140579 missense possibly damaging 0.69
R0281:Slc8a2 UTSW 7 16140989 missense probably benign
R0513:Slc8a2 UTSW 7 16157339 missense probably damaging 1.00
R0811:Slc8a2 UTSW 7 16141114 missense probably damaging 1.00
R0812:Slc8a2 UTSW 7 16141114 missense probably damaging 1.00
R0940:Slc8a2 UTSW 7 16144962 missense probably benign 0.04
R1167:Slc8a2 UTSW 7 16157387 missense possibly damaging 0.58
R1508:Slc8a2 UTSW 7 16140597 missense probably benign 0.00
R1655:Slc8a2 UTSW 7 16141135 missense probably damaging 1.00
R1917:Slc8a2 UTSW 7 16152920 missense probably benign 0.11
R1919:Slc8a2 UTSW 7 16152920 missense probably benign 0.11
R2051:Slc8a2 UTSW 7 16141015 missense probably damaging 1.00
R2083:Slc8a2 UTSW 7 16134515 missense probably damaging 1.00
R2128:Slc8a2 UTSW 7 16140492 splice site probably null
R2149:Slc8a2 UTSW 7 16159164 missense probably damaging 1.00
R3437:Slc8a2 UTSW 7 16158885 missense probably damaging 1.00
R4645:Slc8a2 UTSW 7 16134239 missense probably damaging 1.00
R4741:Slc8a2 UTSW 7 16134308 missense probably damaging 1.00
R4936:Slc8a2 UTSW 7 16134175 nonsense probably null
R5071:Slc8a2 UTSW 7 16150583 missense possibly damaging 0.84
R5072:Slc8a2 UTSW 7 16150583 missense possibly damaging 0.84
R5074:Slc8a2 UTSW 7 16150583 missense possibly damaging 0.84
R5150:Slc8a2 UTSW 7 16145176 missense possibly damaging 0.74
R5358:Slc8a2 UTSW 7 16157303 missense probably damaging 1.00
R5839:Slc8a2 UTSW 7 16134487 missense probably damaging 1.00
R5957:Slc8a2 UTSW 7 16145284 missense possibly damaging 0.90
R6273:Slc8a2 UTSW 7 16145334 missense possibly damaging 0.94
R6363:Slc8a2 UTSW 7 16134045 missense probably benign 0.00
R6881:Slc8a2 UTSW 7 16157357 missense probably damaging 1.00
R7084:Slc8a2 UTSW 7 16145038 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TAGAATTTCATGGGCCGAGGG -3'
(R):5'- ATTCCACAGTGCTGAAGCTG -3'

Sequencing Primer
(F):5'- TTAGAGGGAGCTGGACGAGTC -3'
(R):5'- ACAGTGCTGAAGCTGGACCC -3'
Posted On2015-02-19