Incidental Mutation 'R3618:Zfp42'
ID268519
Institutional Source Beutler Lab
Gene Symbol Zfp42
Ensembl Gene ENSMUSG00000051176
Gene Namezinc finger protein 42
SynonymsZfp-42, Rex-1, Rex1
MMRRC Submission 040675-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3618 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location43295063-43306980 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43295901 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 188 (R188G)
Ref Sequence ENSEMBL: ENSMUSP00000147606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082120] [ENSMUST00000209356] [ENSMUST00000211248]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082120
AA Change: R188G

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080765
Gene: ENSMUSG00000051176
AA Change: R188G

DomainStartEndE-ValueType
low complexity region 111 122 N/A INTRINSIC
ZnF_C2H2 170 194 6.88e-4 SMART
ZnF_C2H2 199 221 2.2e-2 SMART
ZnF_C2H2 227 251 3.95e-4 SMART
ZnF_C2H2 257 281 1.67e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000209356
AA Change: R188G

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211248
AA Change: R188G

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for one knock-out allele exhibit premature age-related male germ cell loss, abnormal sperm morphology, and mild testicular atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,407 E1119G probably damaging Het
5730559C18Rik A C 1: 136,214,372 V663G probably benign Het
Ahnak2 A G 12: 112,786,222 I132T probably damaging Het
Arhgap29 G A 3: 121,988,527 D63N possibly damaging Het
Bsn T A 9: 108,117,561 probably null Het
Cfap161 A C 7: 83,780,182 Y209* probably null Het
Drp2 A C X: 134,439,968 D458A probably benign Het
Efcab6 T C 15: 83,950,069 H446R probably benign Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
F13a1 G A 13: 36,943,993 T337I probably damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Hcfc1 A T X: 73,950,088 V1157D probably benign Het
Ino80 T C 2: 119,446,872 D374G probably null Het
Kif1a T C 1: 93,077,043 E143G probably null Het
Larp1 A T 11: 58,057,346 E990D probably benign Het
Larp7 C A 3: 127,536,965 E568* probably null Het
Ltn1 A T 16: 87,420,899 S298R probably damaging Het
Mcm10 A G 2: 4,997,102 probably null Het
Mef2a G A 7: 67,268,327 S111L probably benign Het
Mroh1 A G 15: 76,452,346 T1590A possibly damaging Het
Ncoa6 A T 2: 155,407,789 H1198Q possibly damaging Het
Ogg1 A G 6: 113,328,373 E49G probably damaging Het
Palm3 T A 8: 84,029,344 V495E probably benign Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Parp3 T C 9: 106,475,063 E88G possibly damaging Het
Ptprs A G 17: 56,428,965 I156T probably benign Het
Pus7l T A 15: 94,527,907 I538F probably damaging Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Ryr2 C T 13: 11,772,580 probably null Het
Slc8a2 A G 7: 16,152,899 N656D possibly damaging Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tbcel T C 9: 42,461,295 probably benign Het
Trpv3 A T 11: 73,295,455 I691F probably damaging Het
Uba2 A G 7: 34,154,482 probably null Het
Usp53 A C 3: 122,934,412 S840R probably benign Het
Vmn2r100 A T 17: 19,523,430 I452F probably benign Het
Zbtb48 A T 4: 152,026,027 probably null Het
Zfp385b G A 2: 77,415,889 P177S probably benign Het
Other mutations in Zfp42
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0325:Zfp42 UTSW 8 43295951 missense probably damaging 0.98
R0648:Zfp42 UTSW 8 43295978 missense probably benign
R1494:Zfp42 UTSW 8 43295601 missense possibly damaging 0.96
R4695:Zfp42 UTSW 8 43296131 missense probably damaging 0.99
R4877:Zfp42 UTSW 8 43295688 missense possibly damaging 0.94
R6683:Zfp42 UTSW 8 43296056 missense possibly damaging 0.88
R6684:Zfp42 UTSW 8 43296056 missense possibly damaging 0.88
R6685:Zfp42 UTSW 8 43296056 missense possibly damaging 0.88
Z1088:Zfp42 UTSW 8 43295805 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- ATGGGTGCGCAAGTTGAAATC -3'
(R):5'- CAGGTTCTGGAAGCGAGTTC -3'

Sequencing Primer
(F):5'- ATCCAGGGAGAAGCGCTTC -3'
(R):5'- CTTCTTTGGAGTACATGACAAAGGG -3'
Posted On2015-02-19