Incidental Mutation 'R3618:Palm3'
ID268520
Institutional Source Beutler Lab
Gene Symbol Palm3
Ensembl Gene ENSMUSG00000047986
Gene Nameparalemmin 3
Synonyms
MMRRC Submission 040675-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R3618 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location84021471-84030295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84029344 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 495 (V495E)
Ref Sequence ENSEMBL: ENSMUSP00000051396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005601] [ENSMUST00000055077]
Predicted Effect probably benign
Transcript: ENSMUST00000005601
SMART Domains Protein: ENSMUSP00000005601
Gene: ENSMUSG00000005465

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:FN3 31 101 2e-6 BLAST
FN3 123 210 3.85e-3 SMART
FN3 314 396 3.78e0 SMART
Blast:FN3 411 492 4e-36 BLAST
low complexity region 516 532 N/A INTRINSIC
low complexity region 584 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055077
AA Change: V495E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000051396
Gene: ENSMUSG00000047986
AA Change: V495E

DomainStartEndE-ValueType
coiled coil region 19 64 N/A INTRINSIC
low complexity region 69 81 N/A INTRINSIC
coiled coil region 90 116 N/A INTRINSIC
low complexity region 167 178 N/A INTRINSIC
low complexity region 248 261 N/A INTRINSIC
low complexity region 277 293 N/A INTRINSIC
low complexity region 337 349 N/A INTRINSIC
low complexity region 399 416 N/A INTRINSIC
low complexity region 635 647 N/A INTRINSIC
low complexity region 707 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210245
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,407 E1119G probably damaging Het
5730559C18Rik A C 1: 136,214,372 V663G probably benign Het
Ahnak2 A G 12: 112,786,222 I132T probably damaging Het
Arhgap29 G A 3: 121,988,527 D63N possibly damaging Het
Bsn T A 9: 108,117,561 probably null Het
Cfap161 A C 7: 83,780,182 Y209* probably null Het
Drp2 A C X: 134,439,968 D458A probably benign Het
Efcab6 T C 15: 83,950,069 H446R probably benign Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
F13a1 G A 13: 36,943,993 T337I probably damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Hcfc1 A T X: 73,950,088 V1157D probably benign Het
Ino80 T C 2: 119,446,872 D374G probably null Het
Kif1a T C 1: 93,077,043 E143G probably null Het
Larp1 A T 11: 58,057,346 E990D probably benign Het
Larp7 C A 3: 127,536,965 E568* probably null Het
Ltn1 A T 16: 87,420,899 S298R probably damaging Het
Mcm10 A G 2: 4,997,102 probably null Het
Mef2a G A 7: 67,268,327 S111L probably benign Het
Mroh1 A G 15: 76,452,346 T1590A possibly damaging Het
Ncoa6 A T 2: 155,407,789 H1198Q possibly damaging Het
Ogg1 A G 6: 113,328,373 E49G probably damaging Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Parp3 T C 9: 106,475,063 E88G possibly damaging Het
Ptprs A G 17: 56,428,965 I156T probably benign Het
Pus7l T A 15: 94,527,907 I538F probably damaging Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Ryr2 C T 13: 11,772,580 probably null Het
Slc8a2 A G 7: 16,152,899 N656D possibly damaging Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tbcel T C 9: 42,461,295 probably benign Het
Trpv3 A T 11: 73,295,455 I691F probably damaging Het
Uba2 A G 7: 34,154,482 probably null Het
Usp53 A C 3: 122,934,412 S840R probably benign Het
Vmn2r100 A T 17: 19,523,430 I452F probably benign Het
Zbtb48 A T 4: 152,026,027 probably null Het
Zfp385b G A 2: 77,415,889 P177S probably benign Het
Zfp42 T C 8: 43,295,901 R188G possibly damaging Het
Other mutations in Palm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Palm3 APN 8 84029445 missense possibly damaging 0.90
IGL02634:Palm3 APN 8 84028865 missense probably damaging 0.99
IGL02710:Palm3 APN 8 84028312 missense possibly damaging 0.75
R0277:Palm3 UTSW 8 84028720 missense probably damaging 1.00
R0323:Palm3 UTSW 8 84028720 missense probably damaging 1.00
R0422:Palm3 UTSW 8 84028863 missense possibly damaging 0.94
R0507:Palm3 UTSW 8 84028329 missense probably benign 0.00
R0835:Palm3 UTSW 8 84028147 missense probably benign
R1037:Palm3 UTSW 8 84029272 missense probably benign
R1618:Palm3 UTSW 8 84029662 missense possibly damaging 0.92
R1621:Palm3 UTSW 8 84030022 missense possibly damaging 0.93
R1797:Palm3 UTSW 8 84028803 missense probably benign 0.00
R1989:Palm3 UTSW 8 84030022 missense possibly damaging 0.93
R3619:Palm3 UTSW 8 84029344 missense probably benign 0.00
R4495:Palm3 UTSW 8 84026866 missense probably damaging 1.00
R4588:Palm3 UTSW 8 84029386 missense probably benign 0.20
R4687:Palm3 UTSW 8 84029935 missense probably benign 0.00
R4948:Palm3 UTSW 8 84027079 nonsense probably null
R5265:Palm3 UTSW 8 84021530 critical splice donor site probably null
R5951:Palm3 UTSW 8 84029420 missense probably benign 0.02
R6580:Palm3 UTSW 8 84029548 missense probably damaging 1.00
R7237:Palm3 UTSW 8 84029488 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGCTGTGCTGCCAGATGAG -3'
(R):5'- TCAGCTTCTTCATCCAATGAGC -3'

Sequencing Primer
(F):5'- TGCTGCCAGATGAGACCCAG -3'
(R):5'- AATGAGCCCTCACCTCCTG -3'
Posted On2015-02-19