Incidental Mutation 'R3618:Larp1'
ID268524
Institutional Source Beutler Lab
Gene Symbol Larp1
Ensembl Gene ENSMUSG00000037331
Gene NameLa ribonucleoprotein domain family, member 1
Synonyms1810024J12Rik, 3110040D16Rik, Larp
MMRRC Submission 040675-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R3618 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58009064-58062034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58057346 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 990 (E990D)
Ref Sequence ENSEMBL: ENSMUSP00000136673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071487] [ENSMUST00000178636]
Predicted Effect probably benign
Transcript: ENSMUST00000071487
AA Change: E990D

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000071421
Gene: ENSMUSG00000037331
AA Change: E990D

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 37 87 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 304 331 N/A INTRINSIC
LA 376 452 1.98e-40 SMART
low complexity region 538 555 N/A INTRINSIC
low complexity region 562 571 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
low complexity region 758 766 N/A INTRINSIC
DM15 861 902 7.3e-20 SMART
DM15 903 941 3.85e-19 SMART
DM15 942 977 8.59e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178636
AA Change: E990D

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000136673
Gene: ENSMUSG00000037331
AA Change: E990D

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 37 87 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 304 331 N/A INTRINSIC
LA 376 452 1.98e-40 SMART
low complexity region 538 555 N/A INTRINSIC
low complexity region 562 571 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
low complexity region 758 766 N/A INTRINSIC
DM15 861 902 7.3e-20 SMART
DM15 903 941 3.85e-19 SMART
DM15 942 977 8.59e-1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,407 E1119G probably damaging Het
5730559C18Rik A C 1: 136,214,372 V663G probably benign Het
Ahnak2 A G 12: 112,786,222 I132T probably damaging Het
Arhgap29 G A 3: 121,988,527 D63N possibly damaging Het
Bsn T A 9: 108,117,561 probably null Het
Cfap161 A C 7: 83,780,182 Y209* probably null Het
Drp2 A C X: 134,439,968 D458A probably benign Het
Efcab6 T C 15: 83,950,069 H446R probably benign Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
F13a1 G A 13: 36,943,993 T337I probably damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Hcfc1 A T X: 73,950,088 V1157D probably benign Het
Ino80 T C 2: 119,446,872 D374G probably null Het
Kif1a T C 1: 93,077,043 E143G probably null Het
Larp7 C A 3: 127,536,965 E568* probably null Het
Ltn1 A T 16: 87,420,899 S298R probably damaging Het
Mcm10 A G 2: 4,997,102 probably null Het
Mef2a G A 7: 67,268,327 S111L probably benign Het
Mroh1 A G 15: 76,452,346 T1590A possibly damaging Het
Ncoa6 A T 2: 155,407,789 H1198Q possibly damaging Het
Ogg1 A G 6: 113,328,373 E49G probably damaging Het
Palm3 T A 8: 84,029,344 V495E probably benign Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Parp3 T C 9: 106,475,063 E88G possibly damaging Het
Ptprs A G 17: 56,428,965 I156T probably benign Het
Pus7l T A 15: 94,527,907 I538F probably damaging Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Ryr2 C T 13: 11,772,580 probably null Het
Slc8a2 A G 7: 16,152,899 N656D possibly damaging Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tbcel T C 9: 42,461,295 probably benign Het
Trpv3 A T 11: 73,295,455 I691F probably damaging Het
Uba2 A G 7: 34,154,482 probably null Het
Usp53 A C 3: 122,934,412 S840R probably benign Het
Vmn2r100 A T 17: 19,523,430 I452F probably benign Het
Zbtb48 A T 4: 152,026,027 probably null Het
Zfp385b G A 2: 77,415,889 P177S probably benign Het
Zfp42 T C 8: 43,295,901 R188G possibly damaging Het
Other mutations in Larp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Larp1 APN 11 58042822 missense possibly damaging 0.91
IGL02114:Larp1 APN 11 58057055 missense probably damaging 1.00
IGL03084:Larp1 APN 11 58057095 missense probably damaging 1.00
IGL03126:Larp1 APN 11 58050877 missense possibly damaging 0.65
IGL03278:Larp1 APN 11 58044056 splice site probably benign
R0009:Larp1 UTSW 11 58055473 missense possibly damaging 0.94
R0020:Larp1 UTSW 11 58050023 missense probably damaging 1.00
R0479:Larp1 UTSW 11 58042820 missense possibly damaging 0.92
R0845:Larp1 UTSW 11 58047750 missense probably benign 0.00
R1691:Larp1 UTSW 11 58048048 missense probably benign 0.08
R1793:Larp1 UTSW 11 58049938 missense possibly damaging 0.60
R4689:Larp1 UTSW 11 58041613 missense probably damaging 1.00
R4797:Larp1 UTSW 11 58047980 nonsense probably null
R5089:Larp1 UTSW 11 58047867 missense possibly damaging 0.92
R5309:Larp1 UTSW 11 58050808 missense possibly damaging 0.72
R5883:Larp1 UTSW 11 58042299 missense probably damaging 0.97
R5951:Larp1 UTSW 11 58049939 missense probably benign 0.14
R6038:Larp1 UTSW 11 58041605 missense possibly damaging 0.68
R6038:Larp1 UTSW 11 58041605 missense possibly damaging 0.68
R6266:Larp1 UTSW 11 58042263 missense probably damaging 0.99
R6350:Larp1 UTSW 11 58049831 missense probably benign 0.14
R6650:Larp1 UTSW 11 58058596 frame shift probably null
R6687:Larp1 UTSW 11 58057330 missense probably damaging 0.99
R6736:Larp1 UTSW 11 58042647 splice site probably null
R6881:Larp1 UTSW 11 58050023 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTAAGAGTGTCAGAGCTGC -3'
(R):5'- TGACACAAACTAGTAGTAGTGGGC -3'

Sequencing Primer
(F):5'- TGTCAGAGCTGCGGGAG -3'
(R):5'- CTAGTAGTAGTGGGCCTGGATAAGC -3'
Posted On2015-02-19