Incidental Mutation 'R3618:Hcfc1'
ID268539
Institutional Source Beutler Lab
Gene Symbol Hcfc1
Ensembl Gene ENSMUSG00000031386
Gene Namehost cell factor C1
SynonymsHCF-1, HCF1, VP16 accessory protein
MMRRC Submission 040675-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.670) question?
Stock #R3618 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location73942792-73966357 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73950088 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1157 (V1157D)
Ref Sequence ENSEMBL: ENSMUSP00000110012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033761] [ENSMUST00000114372]
Predicted Effect probably benign
Transcript: ENSMUST00000033761
AA Change: V1157D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000033761
Gene: ENSMUSG00000031386
AA Change: V1157D

DomainStartEndE-ValueType
Pfam:Kelch_1 32 71 4.3e-7 PFAM
Pfam:Kelch_4 32 81 4.5e-6 PFAM
Pfam:Kelch_3 91 145 5.6e-8 PFAM
Pfam:Kelch_3 146 208 1.5e-6 PFAM
Pfam:Kelch_4 199 254 5.6e-6 PFAM
Pfam:Kelch_3 215 263 2.4e-8 PFAM
Pfam:Kelch_1 254 309 7.5e-8 PFAM
Pfam:Kelch_3 264 330 1.1e-7 PFAM
Pfam:Kelch_5 318 363 7.4e-7 PFAM
Blast:FN3 364 536 5e-61 BLAST
Blast:FN3 538 602 5e-6 BLAST
low complexity region 639 658 N/A INTRINSIC
Blast:FN3 740 932 8e-29 BLAST
low complexity region 933 950 N/A INTRINSIC
internal_repeat_2 975 1018 8.95e-6 PROSPERO
low complexity region 1019 1036 N/A INTRINSIC
internal_repeat_2 1040 1080 8.95e-6 PROSPERO
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1114 1130 N/A INTRINSIC
low complexity region 1135 1149 N/A INTRINSIC
low complexity region 1164 1182 N/A INTRINSIC
low complexity region 1235 1247 N/A INTRINSIC
low complexity region 1273 1282 N/A INTRINSIC
low complexity region 1308 1321 N/A INTRINSIC
low complexity region 1332 1346 N/A INTRINSIC
low complexity region 1349 1363 N/A INTRINSIC
low complexity region 1371 1384 N/A INTRINSIC
low complexity region 1432 1446 N/A INTRINSIC
low complexity region 1472 1488 N/A INTRINSIC
low complexity region 1493 1510 N/A INTRINSIC
low complexity region 1519 1530 N/A INTRINSIC
low complexity region 1569 1591 N/A INTRINSIC
low complexity region 1616 1655 N/A INTRINSIC
coiled coil region 1693 1723 N/A INTRINSIC
FN3 1805 1885 1.39e0 SMART
FN3 1901 2002 1.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114372
AA Change: V1157D

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110012
Gene: ENSMUSG00000031386
AA Change: V1157D

DomainStartEndE-ValueType
Pfam:Kelch_5 29 67 6.1e-7 PFAM
Pfam:Kelch_1 32 70 5e-8 PFAM
Pfam:Kelch_4 32 80 1.8e-7 PFAM
Pfam:Kelch_3 91 145 1.2e-8 PFAM
Pfam:Kelch_3 215 263 3.4e-9 PFAM
Pfam:Kelch_1 254 309 3.1e-7 PFAM
Pfam:Kelch_3 264 330 8.3e-8 PFAM
PDB:4GO6|C 360 402 1e-21 PDB
Blast:FN3 364 536 6e-61 BLAST
Blast:FN3 538 602 6e-6 BLAST
low complexity region 639 658 N/A INTRINSIC
Blast:FN3 740 932 1e-28 BLAST
low complexity region 933 950 N/A INTRINSIC
internal_repeat_2 975 1018 2.29e-5 PROSPERO
low complexity region 1019 1036 N/A INTRINSIC
internal_repeat_2 1040 1080 2.29e-5 PROSPERO
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1114 1130 N/A INTRINSIC
low complexity region 1135 1149 N/A INTRINSIC
low complexity region 1164 1182 N/A INTRINSIC
low complexity region 1235 1247 N/A INTRINSIC
low complexity region 1273 1282 N/A INTRINSIC
low complexity region 1308 1321 N/A INTRINSIC
low complexity region 1332 1346 N/A INTRINSIC
low complexity region 1349 1363 N/A INTRINSIC
low complexity region 1371 1384 N/A INTRINSIC
low complexity region 1432 1446 N/A INTRINSIC
low complexity region 1472 1488 N/A INTRINSIC
low complexity region 1563 1574 N/A INTRINSIC
low complexity region 1613 1635 N/A INTRINSIC
low complexity region 1660 1701 N/A INTRINSIC
coiled coil region 1738 1768 N/A INTRINSIC
FN3 1850 1930 1.39e0 SMART
FN3 1946 2047 1.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128136
SMART Domains Protein: ENSMUSP00000115792
Gene: ENSMUSG00000031386

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 38 54 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 85 96 N/A INTRINSIC
low complexity region 135 157 N/A INTRINSIC
low complexity region 182 223 N/A INTRINSIC
coiled coil region 259 289 N/A INTRINSIC
FN3 372 452 1.39e0 SMART
FN3 468 569 1.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156204
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transcription cofactor that regulates the progression of cell cycle and maintain the ability of embryonic stem cells to self-renew. The encoded protein is a large precursor that undergoes site-specific proteolytic cleavage to yield N- and C-terminal chains that form a non-covalent heterodimer. The encoded protein has been implicated in the regulation of expression of immediate early genes after herpes simplex virus infection and glucose-stimulated secretion of insulin by pancreatic beta cells. [provided by RefSeq, Aug 2015]
PHENOTYPE: Conditional loss of the maternally inherited allele is embryonic lethal with increased apoptosis and reduced cell proliferation. Liver-specific knockout leads to decreased liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,407 E1119G probably damaging Het
5730559C18Rik A C 1: 136,214,372 V663G probably benign Het
Ahnak2 A G 12: 112,786,222 I132T probably damaging Het
Arhgap29 G A 3: 121,988,527 D63N possibly damaging Het
Bsn T A 9: 108,117,561 probably null Het
Cfap161 A C 7: 83,780,182 Y209* probably null Het
Drp2 A C X: 134,439,968 D458A probably benign Het
Efcab6 T C 15: 83,950,069 H446R probably benign Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
F13a1 G A 13: 36,943,993 T337I probably damaging Het
Fhod3 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 18: 25,020,665 probably benign Het
Ino80 T C 2: 119,446,872 D374G probably null Het
Kif1a T C 1: 93,077,043 E143G probably null Het
Larp1 A T 11: 58,057,346 E990D probably benign Het
Larp7 C A 3: 127,536,965 E568* probably null Het
Ltn1 A T 16: 87,420,899 S298R probably damaging Het
Mcm10 A G 2: 4,997,102 probably null Het
Mef2a G A 7: 67,268,327 S111L probably benign Het
Mroh1 A G 15: 76,452,346 T1590A possibly damaging Het
Ncoa6 A T 2: 155,407,789 H1198Q possibly damaging Het
Ogg1 A G 6: 113,328,373 E49G probably damaging Het
Palm3 T A 8: 84,029,344 V495E probably benign Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Parp3 T C 9: 106,475,063 E88G possibly damaging Het
Ptprs A G 17: 56,428,965 I156T probably benign Het
Pus7l T A 15: 94,527,907 I538F probably damaging Het
Rgs8 A G 1: 153,690,996 T98A probably null Het
Ryr2 C T 13: 11,772,580 probably null Het
Slc8a2 A G 7: 16,152,899 N656D possibly damaging Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tbcel T C 9: 42,461,295 probably benign Het
Trpv3 A T 11: 73,295,455 I691F probably damaging Het
Uba2 A G 7: 34,154,482 probably null Het
Usp53 A C 3: 122,934,412 S840R probably benign Het
Vmn2r100 A T 17: 19,523,430 I452F probably benign Het
Zbtb48 A T 4: 152,026,027 probably null Het
Zfp385b G A 2: 77,415,889 P177S probably benign Het
Zfp42 T C 8: 43,295,901 R188G possibly damaging Het
Other mutations in Hcfc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Hcfc1 APN X 73949909 missense possibly damaging 0.92
IGL03191:Hcfc1 APN X 73955614 missense probably benign 0.30
IGL03198:Hcfc1 APN X 73951329 missense possibly damaging 0.69
R0242:Hcfc1 UTSW X 73948429 intron probably benign
R4302:Hcfc1 UTSW X 73949366 missense probably benign 0.15
R4785:Hcfc1 UTSW X 73965946 missense probably damaging 0.99
R6711:Hcfc1 UTSW X 73950065 missense probably damaging 0.99
X0021:Hcfc1 UTSW X 73952314 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCCCAACTCTGACACTTGG -3'
(R):5'- ATGAGACGGGCACTACCAAC -3'

Sequencing Primer
(F):5'- CTCTGACACTTGGAAGGGCTAG -3'
(R):5'- TCCAACATGGCTGGGCAG -3'
Posted On2015-02-19