Incidental Mutation 'R3619:Lrif1'
ID268549
Institutional Source Beutler Lab
Gene Symbol Lrif1
Ensembl Gene ENSMUSG00000056260
Gene Nameligand dependent nuclear receptor interacting factor 1
Synonyms2010012G17Rik, 4933421E11Rik
MMRRC Submission 040676-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R3619 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location106684987-106736577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106732546 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 316 (K316E)
Ref Sequence ENSEMBL: ENSMUSP00000114163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098750] [ENSMUST00000098751] [ENSMUST00000106736] [ENSMUST00000127003] [ENSMUST00000130105] [ENSMUST00000150513] [ENSMUST00000154973]
Predicted Effect probably damaging
Transcript: ENSMUST00000098750
AA Change: K316E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096346
Gene: ENSMUSG00000056260
AA Change: K316E

DomainStartEndE-ValueType
Pfam:LRIF1 22 753 1.7e-292 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098751
SMART Domains Protein: ENSMUSP00000096347
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
low complexity region 104 117 N/A INTRINSIC
coiled coil region 225 257 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106736
SMART Domains Protein: ENSMUSP00000102347
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
low complexity region 84 97 N/A INTRINSIC
coiled coil region 205 237 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106737
SMART Domains Protein: ENSMUSP00000102348
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
Pfam:LRIF1 22 347 6.2e-145 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122928
Predicted Effect probably damaging
Transcript: ENSMUST00000127003
AA Change: K316E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114163
Gene: ENSMUSG00000056260
AA Change: K316E

DomainStartEndE-ValueType
low complexity region 74 92 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130105
SMART Domains Protein: ENSMUSP00000115110
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
low complexity region 49 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150513
SMART Domains Protein: ENSMUSP00000119815
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
low complexity region 49 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150888
Predicted Effect probably benign
Transcript: ENSMUST00000154973
SMART Domains Protein: ENSMUSP00000120350
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
low complexity region 49 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194058
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc82 T A 9: 13,252,306 D74E probably benign Het
Chmp3 T A 6: 71,577,825 I168N probably damaging Het
Dazap1 T C 10: 80,285,360 probably benign Het
Dpp6 T C 5: 27,721,120 S673P possibly damaging Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
Fgf11 T C 11: 69,799,408 S118G probably benign Het
Foxi3 T C 6: 70,957,063 L178P probably damaging Het
Gbx1 G T 5: 24,526,113 P235Q probably benign Het
Gm8267 A T 14: 44,724,056 M60K possibly damaging Het
Gnmt G A 17: 46,729,037 R39C possibly damaging Het
Hnrnpab T C 11: 51,602,611 N257D possibly damaging Het
Klhl31 G T 9: 77,655,476 A508S probably benign Het
Magi3 A T 3: 104,054,405 F436I probably damaging Het
Mef2a G A 7: 67,268,327 S111L probably benign Het
Micu1 T C 10: 59,768,258 probably null Het
Mpst A G 15: 78,410,122 E18G probably damaging Het
Npepps G T 11: 97,248,265 F160L possibly damaging Het
Olfr118 T A 17: 37,672,640 F206I probably benign Het
Olfr510 A T 7: 108,667,850 I145F probably benign Het
Orc6 T C 8: 85,299,994 probably null Het
Palm3 T A 8: 84,029,344 V495E probably benign Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Pcdh15 T C 10: 74,643,395 V708A probably damaging Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plxna1 C A 6: 89,357,453 A65S probably damaging Het
Ptprt T C 2: 161,566,157 Y945C probably damaging Het
Pym1 T G 10: 128,765,204 V31G probably damaging Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tas1r3 C T 4: 155,860,953 V604I probably damaging Het
Ttc27 G A 17: 74,751,128 probably null Het
Wfdc6b A T 2: 164,614,906 Y46F probably benign Het
Zbtb48 A T 4: 152,026,027 probably null Het
Zfp385b G A 2: 77,415,889 P177S probably benign Het
Other mutations in Lrif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Lrif1 APN 3 106734641 critical splice donor site probably null
IGL01121:Lrif1 APN 3 106735664 nonsense probably null
IGL01304:Lrif1 APN 3 106731733 missense probably damaging 1.00
IGL02209:Lrif1 APN 3 106731729 missense probably damaging 1.00
IGL02801:Lrif1 APN 3 106734614 missense possibly damaging 0.89
IGL02796:Lrif1 UTSW 3 106735436 missense probably benign 0.25
R0440:Lrif1 UTSW 3 106734398 missense possibly damaging 0.87
R0456:Lrif1 UTSW 3 106731778 missense probably benign 0.06
R0561:Lrif1 UTSW 3 106732165 missense probably damaging 1.00
R1160:Lrif1 UTSW 3 106732717 missense possibly damaging 0.95
R1720:Lrif1 UTSW 3 106733136 missense probably damaging 1.00
R1735:Lrif1 UTSW 3 106735846 makesense probably null
R1843:Lrif1 UTSW 3 106732811 missense probably damaging 0.99
R2016:Lrif1 UTSW 3 106732206 missense possibly damaging 0.94
R2200:Lrif1 UTSW 3 106734558 missense probably damaging 0.98
R4750:Lrif1 UTSW 3 106735564 missense probably benign 0.33
R4878:Lrif1 UTSW 3 106735640 missense probably damaging 1.00
R4945:Lrif1 UTSW 3 106735753 missense probably damaging 1.00
R5286:Lrif1 UTSW 3 106732543 missense probably damaging 0.97
R5682:Lrif1 UTSW 3 106732568 missense possibly damaging 0.70
R6149:Lrif1 UTSW 3 106732327 missense possibly damaging 0.83
R6665:Lrif1 UTSW 3 106735343 intron probably null
R7011:Lrif1 UTSW 3 106732285 missense probably damaging 1.00
Z1088:Lrif1 UTSW 3 106732570 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCAAATTCCACCAAATGTTGC -3'
(R):5'- TTGGCCATGGAAGCAAGCTG -3'

Sequencing Primer
(F):5'- ATTCCACCAAATGTTGCTACAG -3'
(R):5'- CTTGAACTTACTAGCTGTGATGAATC -3'
Posted On2015-02-19