Incidental Mutation 'R3619:Mef2a'
ID268560
Institutional Source Beutler Lab
Gene Symbol Mef2a
Ensembl Gene ENSMUSG00000030557
Gene Namemyocyte enhancer factor 2A
SynonymsA430079H05Rik
MMRRC Submission 040676-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3619 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location67231163-67372858 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67268327 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 111 (S111L)
Ref Sequence ENSEMBL: ENSMUSP00000116144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032776] [ENSMUST00000072460] [ENSMUST00000076325] [ENSMUST00000107476] [ENSMUST00000133074] [ENSMUST00000135493] [ENSMUST00000156690] [ENSMUST00000207715] [ENSMUST00000208512]
Predicted Effect probably benign
Transcript: ENSMUST00000032776
SMART Domains Protein: ENSMUSP00000032776
Gene: ENSMUSG00000030557

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 155 5.2e-30 PFAM
low complexity region 161 181 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 301 316 N/A INTRINSIC
low complexity region 412 431 N/A INTRINSIC
low complexity region 438 457 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072460
SMART Domains Protein: ENSMUSP00000138645
Gene: ENSMUSG00000030557

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076325
SMART Domains Protein: ENSMUSP00000075664
Gene: ENSMUSG00000030557

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 155 5.2e-30 PFAM
low complexity region 161 181 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 301 316 N/A INTRINSIC
low complexity region 412 431 N/A INTRINSIC
low complexity region 438 457 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107476
AA Change: S111L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103100
Gene: ENSMUSG00000030557
AA Change: S111L

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 153 3.7e-8 PFAM
low complexity region 159 179 N/A INTRINSIC
low complexity region 253 263 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
low complexity region 410 429 N/A INTRINSIC
low complexity region 436 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133074
AA Change: S111L

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116144
Gene: ENSMUSG00000030557
AA Change: S111L

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 153 8.7e-9 PFAM
low complexity region 159 179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135493
AA Change: S111L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138566
Gene: ENSMUSG00000030557
AA Change: S111L

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 153 3.7e-8 PFAM
low complexity region 159 179 N/A INTRINSIC
low complexity region 253 263 N/A INTRINSIC
low complexity region 288 294 N/A INTRINSIC
low complexity region 307 322 N/A INTRINSIC
low complexity region 418 437 N/A INTRINSIC
low complexity region 444 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156690
AA Change: S111L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117496
Gene: ENSMUSG00000030557
AA Change: S111L

DomainStartEndE-ValueType
MADS 1 60 6.15e-37 SMART
Pfam:HJURP_C 90 152 1.3e-8 PFAM
low complexity region 159 179 N/A INTRINSIC
low complexity region 253 263 N/A INTRINSIC
low complexity region 288 294 N/A INTRINSIC
low complexity region 307 322 N/A INTRINSIC
low complexity region 418 437 N/A INTRINSIC
low complexity region 444 463 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207632
Predicted Effect probably benign
Transcript: ENSMUST00000207715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207794
Predicted Effect probably benign
Transcript: ENSMUST00000208512
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA-binding transcription factor that activates many muscle-specific, growth factor-induced, and stress-induced genes. The encoded protein can act as a homodimer or as a heterodimer and is involved in several cellular processes, including muscle development, neuronal differentiation, cell growth control, and apoptosis. Defects in this gene could be a cause of autosomal dominant coronary artery disease 1 with myocardial infarction (ADCAD1). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Inactivation of this gene results in cardiac sudden death. Mice dying in the early postnatal period exhibit ventricular dilation, while mice dying in adulthood show a reduced number of mitochondria in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc82 T A 9: 13,252,306 D74E probably benign Het
Chmp3 T A 6: 71,577,825 I168N probably damaging Het
Dazap1 T C 10: 80,285,360 probably benign Het
Dpp6 T C 5: 27,721,120 S673P possibly damaging Het
Enpep G C 3: 129,284,158 S603R possibly damaging Het
Fgf11 T C 11: 69,799,408 S118G probably benign Het
Foxi3 T C 6: 70,957,063 L178P probably damaging Het
Gbx1 G T 5: 24,526,113 P235Q probably benign Het
Gm8267 A T 14: 44,724,056 M60K possibly damaging Het
Gnmt G A 17: 46,729,037 R39C possibly damaging Het
Hnrnpab T C 11: 51,602,611 N257D possibly damaging Het
Klhl31 G T 9: 77,655,476 A508S probably benign Het
Lrif1 A G 3: 106,732,546 K316E probably damaging Het
Magi3 A T 3: 104,054,405 F436I probably damaging Het
Micu1 T C 10: 59,768,258 probably null Het
Mpst A G 15: 78,410,122 E18G probably damaging Het
Npepps G T 11: 97,248,265 F160L possibly damaging Het
Olfr118 T A 17: 37,672,640 F206I probably benign Het
Olfr510 A T 7: 108,667,850 I145F probably benign Het
Orc6 T C 8: 85,299,994 probably null Het
Palm3 T A 8: 84,029,344 V495E probably benign Het
Pam A G 1: 97,834,432 F809L probably damaging Het
Pcdh15 T C 10: 74,643,395 V708A probably damaging Het
Pcdha12 G A 18: 37,020,704 D159N probably damaging Het
Plxna1 C A 6: 89,357,453 A65S probably damaging Het
Ptprt T C 2: 161,566,157 Y945C probably damaging Het
Pym1 T G 10: 128,765,204 V31G probably damaging Het
Stard9 C T 2: 120,699,019 T1919I possibly damaging Het
Tas1r3 C T 4: 155,860,953 V604I probably damaging Het
Ttc27 G A 17: 74,751,128 probably null Het
Wfdc6b A T 2: 164,614,906 Y46F probably benign Het
Zbtb48 A T 4: 152,026,027 probably null Het
Zfp385b G A 2: 77,415,889 P177S probably benign Het
Other mutations in Mef2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01923:Mef2a APN 7 67264872 missense probably damaging 0.98
IGL02112:Mef2a APN 7 67264872 missense probably damaging 0.98
P0024:Mef2a UTSW 7 67295574 missense probably damaging 1.00
R0390:Mef2a UTSW 7 67251724 missense probably damaging 0.96
R0583:Mef2a UTSW 7 67235148 nonsense probably null
R0584:Mef2a UTSW 7 67235148 nonsense probably null
R0589:Mef2a UTSW 7 67235148 nonsense probably null
R0597:Mef2a UTSW 7 67235148 nonsense probably null
R0608:Mef2a UTSW 7 67235148 nonsense probably null
R0704:Mef2a UTSW 7 67235148 nonsense probably null
R1859:Mef2a UTSW 7 67266018 missense probably damaging 0.97
R2166:Mef2a UTSW 7 67266122 missense probably damaging 1.00
R2427:Mef2a UTSW 7 67266060 missense probably damaging 0.98
R3618:Mef2a UTSW 7 67268327 missense probably benign 0.34
R4576:Mef2a UTSW 7 67240439 missense probably benign 0.00
R4577:Mef2a UTSW 7 67240439 missense probably benign 0.00
R4578:Mef2a UTSW 7 67240439 missense probably benign 0.00
R4635:Mef2a UTSW 7 67240427 missense possibly damaging 0.67
R5805:Mef2a UTSW 7 67251668 missense possibly damaging 0.89
X0011:Mef2a UTSW 7 67235164 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTATCAGGGTCTGGGCTG -3'
(R):5'- GGCTTATGGTACTTGCAGAACTG -3'

Sequencing Primer
(F):5'- GGCTGTCGCACCCTCTG -3'
(R):5'- ACAGAACCTGTGTATTCGACCTGTG -3'
Posted On2015-02-19