Incidental Mutation 'R3621:Erich3'
ID268627
Institutional Source Beutler Lab
Gene Symbol Erich3
Ensembl Gene ENSMUSG00000078161
Gene Nameglutamate rich 3
Synonyms4922501L14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R3621 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location154663859-154767790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154748732 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 515 (Y515H)
Ref Sequence ENSEMBL: ENSMUSP00000062837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051862] [ENSMUST00000098496]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051862
AA Change: Y515H

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062837
Gene: ENSMUSG00000078161
AA Change: Y515H

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:DUF4590 102 217 9.8e-62 PFAM
low complexity region 299 327 N/A INTRINSIC
low complexity region 382 395 N/A INTRINSIC
low complexity region 408 420 N/A INTRINSIC
low complexity region 441 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098496
SMART Domains Protein: ENSMUSP00000096097
Gene: ENSMUSG00000078161

DomainStartEndE-ValueType
internal_repeat_1 18 102 3.73e-10 PROSPERO
internal_repeat_1 155 240 3.73e-10 PROSPERO
low complexity region 501 514 N/A INTRINSIC
low complexity region 756 773 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172865
SMART Domains Protein: ENSMUSP00000133995
Gene: ENSMUSG00000042943

DomainStartEndE-ValueType
Pfam:DUF4590 300 413 2.6e-58 PFAM
low complexity region 496 524 N/A INTRINSIC
low complexity region 579 592 N/A INTRINSIC
low complexity region 605 617 N/A INTRINSIC
low complexity region 638 648 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 A G 19: 57,152,303 S161P probably damaging Het
Atp8a2 C A 14: 60,026,138 probably null Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Cep192 T C 18: 67,829,857 V648A probably benign Het
Csmd1 T C 8: 15,992,684 S2350G probably benign Het
Enpp6 T C 8: 47,065,505 W223R probably benign Het
Fam118a T C 15: 85,045,801 F77L probably damaging Het
Fsip2 C A 2: 82,980,258 T2307K probably benign Het
Gcg T C 2: 62,476,935 E94G probably damaging Het
Hdc T A 2: 126,616,267 Y45F possibly damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hspa8 A T 9: 40,801,923 M1L probably damaging Het
Ilvbl G A 10: 78,577,180 V179M probably damaging Het
Mettl4 T C 17: 94,735,508 Y300C probably damaging Het
Olfr77 T C 9: 19,920,913 Y235H probably damaging Het
Otogl T C 10: 107,874,371 D619G probably damaging Het
Pnpla1 C T 17: 28,877,388 A147V probably damaging Het
Slc24a4 T C 12: 102,218,963 F111L probably damaging Het
Tep1 G A 14: 50,829,020 R2328C probably damaging Het
Thbs1 T C 2: 118,121,159 V820A probably benign Het
Timd2 G A 11: 46,678,213 T206I probably benign Het
Zfp445 C T 9: 122,852,768 A703T probably benign Het
Zpbp2 A G 11: 98,552,556 T18A probably benign Het
Other mutations in Erich3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Erich3 APN 3 154748519 missense probably benign 0.44
IGL01141:Erich3 APN 3 154714016 missense probably benign 0.08
IGL01812:Erich3 APN 3 154713971 missense possibly damaging 0.70
IGL02126:Erich3 APN 3 154713962 missense possibly damaging 0.60
IGL03371:Erich3 APN 3 154727477 missense probably damaging 0.97
IGL03386:Erich3 APN 3 154739239 missense possibly damaging 0.80
FR4449:Erich3 UTSW 3 154763513 unclassified probably benign
R0942:Erich3 UTSW 3 154739151 missense probably benign 0.00
R1558:Erich3 UTSW 3 154714068 missense probably damaging 0.99
R1582:Erich3 UTSW 3 154764323 unclassified probably benign
R1674:Erich3 UTSW 3 154762623 unclassified probably benign
R1676:Erich3 UTSW 3 154762623 unclassified probably benign
R1724:Erich3 UTSW 3 154762327 missense possibly damaging 0.89
R1757:Erich3 UTSW 3 154695765 missense probably damaging 0.98
R1771:Erich3 UTSW 3 154748472 missense possibly damaging 0.82
R2384:Erich3 UTSW 3 154764651 missense possibly damaging 0.92
R2410:Erich3 UTSW 3 154733603 missense probably damaging 0.98
R2507:Erich3 UTSW 3 154698659 missense probably null 1.00
R3755:Erich3 UTSW 3 154764321 unclassified probably benign
R3756:Erich3 UTSW 3 154764321 unclassified probably benign
R3756:Erich3 UTSW 3 154764578 missense possibly damaging 0.66
R3832:Erich3 UTSW 3 154762361 missense probably damaging 0.97
R4020:Erich3 UTSW 3 154714049 missense probably damaging 0.97
R4601:Erich3 UTSW 3 154764738 missense unknown
R4628:Erich3 UTSW 3 154763687 missense probably damaging 1.00
R4841:Erich3 UTSW 3 154704843 missense possibly damaging 0.87
R4842:Erich3 UTSW 3 154704843 missense possibly damaging 0.87
R4863:Erich3 UTSW 3 154764804 missense unknown
R4989:Erich3 UTSW 3 154748388 missense possibly damaging 0.85
R5310:Erich3 UTSW 3 154763580 missense probably damaging 1.00
R5596:Erich3 UTSW 3 154727396 missense probably damaging 0.99
R5695:Erich3 UTSW 3 154733573 missense probably damaging 1.00
R5742:Erich3 UTSW 3 154733323 missense probably damaging 1.00
R5859:Erich3 UTSW 3 154762497 missense possibly damaging 0.90
R5916:Erich3 UTSW 3 154695823 missense probably damaging 1.00
R6172:Erich3 UTSW 3 154764341 missense possibly damaging 0.66
R6321:Erich3 UTSW 3 154727502 missense probably damaging 1.00
R6438:Erich3 UTSW 3 154695753 missense probably damaging 1.00
R6520:Erich3 UTSW 3 154763465 missense probably damaging 0.98
R6679:Erich3 UTSW 3 154762429 missense possibly damaging 0.81
R6697:Erich3 UTSW 3 154764270 unclassified probably benign
R6800:Erich3 UTSW 3 154727392 critical splice acceptor site probably null
R6823:Erich3 UTSW 3 154727437 missense probably damaging 1.00
R6855:Erich3 UTSW 3 154762649 nonsense probably null
R6989:Erich3 UTSW 3 154763677 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATAACGGACCTTGGTTGACC -3'
(R):5'- CTTTGACTTCATACATGCATTGCG -3'

Sequencing Primer
(F):5'- ACCTTGGTTGACCGAGCTCAG -3'
(R):5'- ACATGCATTGCGTTTTATTTGATTC -3'
Posted On2015-02-19