Incidental Mutation 'R3622:Olfr994'
ID268653
Institutional Source Beutler Lab
Gene Symbol Olfr994
Ensembl Gene ENSMUSG00000075219
Gene Nameolfactory receptor 994
SynonymsMOR203-4, GA_x6K02T2Q125-46907515-46906571
MMRRC Submission 040677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R3622 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85429380-85436451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85430493 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 112 (C112Y)
Ref Sequence ENSEMBL: ENSMUSP00000149417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099925] [ENSMUST00000214679] [ENSMUST00000217218]
Predicted Effect probably benign
Transcript: ENSMUST00000099925
AA Change: C112Y

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097509
Gene: ENSMUSG00000075219
AA Change: C112Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 5.1e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 302 3.5e-5 PFAM
Pfam:7tm_1 41 289 8.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214679
AA Change: C112Y

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215758
Predicted Effect probably benign
Transcript: ENSMUST00000217218
AA Change: C112Y

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.272 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,350,813 Y503* probably null Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dpf1 G A 7: 29,316,206 probably null Het
Grid2ip T C 5: 143,386,019 S666P probably damaging Het
Gucy2e T A 11: 69,225,051 E835V probably damaging Het
Hdac5 G A 11: 102,195,818 P120S probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap A T 4: 56,759,925 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Muc5b T C 7: 141,851,858 probably benign Het
Olfr1461 T A 19: 13,165,656 M214K probably benign Het
Olfr390 A G 11: 73,787,741 T268A probably benign Het
Olfr912 A G 9: 38,581,496 Y73C probably damaging Het
Oma1 T C 4: 103,366,091 I491T probably benign Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Plin4 G T 17: 56,104,112 T973K possibly damaging Het
R3hdm4 C T 10: 79,912,681 R143H possibly damaging Het
Rps18 G C 17: 33,952,273 probably null Het
Samd9l A T 6: 3,374,032 C1076* probably null Het
Scml4 T C 10: 42,930,611 probably benign Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Slc6a5 T C 7: 49,917,623 V275A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Srsf9 C T 5: 115,330,512 A69V probably damaging Het
Stfa2 A G 16: 36,404,071 Y90H probably damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Tnrc6c C T 11: 117,749,625 R1414C probably damaging Het
Tyk2 A T 9: 21,127,310 C8S probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Utp20 A G 10: 88,757,993 probably benign Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r116 A G 17: 23,386,051 S113G probably benign Het
Vps53 A C 11: 76,117,783 V237G probably benign Het
Other mutations in Olfr994
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Olfr994 APN 2 85430140 missense probably benign 0.00
IGL01325:Olfr994 APN 2 85430295 missense possibly damaging 0.60
IGL01634:Olfr994 APN 2 85430439 missense probably damaging 1.00
IGL01809:Olfr994 APN 2 85430154 missense probably damaging 1.00
IGL02586:Olfr994 APN 2 85430466 missense possibly damaging 0.80
IGL02711:Olfr994 APN 2 85430739 missense probably damaging 0.97
R0010:Olfr994 UTSW 2 85429895 missense probably benign
R0578:Olfr994 UTSW 2 85430673 missense probably benign 0.03
R0848:Olfr994 UTSW 2 85430021 missense probably benign 0.03
R1844:Olfr994 UTSW 2 85429921 missense probably benign 0.03
R1912:Olfr994 UTSW 2 85430260 missense probably damaging 0.97
R1959:Olfr994 UTSW 2 85430619 missense probably damaging 1.00
R2014:Olfr994 UTSW 2 85430352 missense possibly damaging 0.89
R2113:Olfr994 UTSW 2 85430086 missense probably damaging 1.00
R2290:Olfr994 UTSW 2 85430200 missense possibly damaging 0.64
R3918:Olfr994 UTSW 2 85430730 missense possibly damaging 0.64
R4175:Olfr994 UTSW 2 85430618 missense probably damaging 1.00
R4945:Olfr994 UTSW 2 85430551 missense probably benign 0.03
R6132:Olfr994 UTSW 2 85430146 missense probably benign 0.06
R6439:Olfr994 UTSW 2 85430724 missense probably damaging 1.00
R6713:Olfr994 UTSW 2 85430539 missense probably damaging 1.00
R7065:Olfr994 UTSW 2 85430179 missense probably damaging 1.00
R7089:Olfr994 UTSW 2 85430558 missense probably benign 0.00
R7467:Olfr994 UTSW 2 85430827 start codon destroyed possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACAATTGGCGGAATGTCACAG -3'
(R):5'- CTGACTCCAGACTTCAGACTC -3'

Sequencing Primer
(F):5'- TTTTTGATGCACAGAAGGACAGTG -3'
(R):5'- TCCAGACTTCAGACTCCCATG -3'
Posted On2015-02-19