Incidental Mutation 'R3622:Htr1d'
ID268662
Institutional Source Beutler Lab
Gene Symbol Htr1d
Ensembl Gene ENSMUSG00000070687
Gene Name5-hydroxytryptamine (serotonin) receptor 1D
SynonymsGpcr14, Htr1db
MMRRC Submission 040677-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3622 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location136423524-136444398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136443504 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 348 (I348T)
Ref Sequence ENSEMBL: ENSMUSP00000112402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088677] [ENSMUST00000117699] [ENSMUST00000121571]
Predicted Effect probably damaging
Transcript: ENSMUST00000088677
AA Change: I348T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086052
Gene: ENSMUSG00000070687
AA Change: I348T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 46 368 1.2e-11 PFAM
Pfam:7tm_1 52 353 1.2e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117699
AA Change: I348T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112840
Gene: ENSMUSG00000070687
AA Change: I348T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 46 368 1.2e-11 PFAM
Pfam:7tm_1 52 353 2.7e-86 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121571
AA Change: I348T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112402
Gene: ENSMUSG00000070687
AA Change: I348T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 46 368 1.2e-11 PFAM
Pfam:7tm_1 52 353 2.7e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133818
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,350,813 Y503* probably null Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dpf1 G A 7: 29,316,206 probably null Het
Grid2ip T C 5: 143,386,019 S666P probably damaging Het
Gucy2e T A 11: 69,225,051 E835V probably damaging Het
Hdac5 G A 11: 102,195,818 P120S probably benign Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap A T 4: 56,759,925 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Muc5b T C 7: 141,851,858 probably benign Het
Olfr1461 T A 19: 13,165,656 M214K probably benign Het
Olfr390 A G 11: 73,787,741 T268A probably benign Het
Olfr912 A G 9: 38,581,496 Y73C probably damaging Het
Olfr994 C T 2: 85,430,493 C112Y probably benign Het
Oma1 T C 4: 103,366,091 I491T probably benign Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Plin4 G T 17: 56,104,112 T973K possibly damaging Het
R3hdm4 C T 10: 79,912,681 R143H possibly damaging Het
Rps18 G C 17: 33,952,273 probably null Het
Samd9l A T 6: 3,374,032 C1076* probably null Het
Scml4 T C 10: 42,930,611 probably benign Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Slc6a5 T C 7: 49,917,623 V275A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Srsf9 C T 5: 115,330,512 A69V probably damaging Het
Stfa2 A G 16: 36,404,071 Y90H probably damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Tnrc6c C T 11: 117,749,625 R1414C probably damaging Het
Tyk2 A T 9: 21,127,310 C8S probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Utp20 A G 10: 88,757,993 probably benign Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r116 A G 17: 23,386,051 S113G probably benign Het
Vps53 A C 11: 76,117,783 V237G probably benign Het
Other mutations in Htr1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Htr1d APN 4 136443173 missense probably benign 0.03
IGL01818:Htr1d APN 4 136442886 missense probably benign 0.02
IGL01952:Htr1d APN 4 136443561 missense probably benign 0.08
IGL02696:Htr1d APN 4 136443411 missense probably benign 0.00
R0112:Htr1d UTSW 4 136443000 missense probably benign 0.05
R0147:Htr1d UTSW 4 136443477 missense probably damaging 1.00
R0148:Htr1d UTSW 4 136443477 missense probably damaging 1.00
R2483:Htr1d UTSW 4 136443504 missense probably damaging 0.97
R2764:Htr1d UTSW 4 136443065 missense possibly damaging 0.89
R3623:Htr1d UTSW 4 136443504 missense probably damaging 0.97
R3624:Htr1d UTSW 4 136443504 missense probably damaging 0.97
R3894:Htr1d UTSW 4 136443237 missense probably benign 0.00
R4567:Htr1d UTSW 4 136443525 missense probably benign 0.17
R4735:Htr1d UTSW 4 136442886 missense probably benign 0.02
R6190:Htr1d UTSW 4 136442798 missense probably damaging 1.00
R7011:Htr1d UTSW 4 136443006 missense probably benign 0.10
R7123:Htr1d UTSW 4 136442353 start gained probably benign
R7223:Htr1d UTSW 4 136443501 missense probably damaging 1.00
R7328:Htr1d UTSW 4 136443303 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAGGTGAAAATCAAGCTTGC -3'
(R):5'- ACCCGGGTCTCAGAGAAATG -3'

Sequencing Primer
(F):5'- TCCTAGAACGCAAGAGGATCTCTG -3'
(R):5'- GGCAGTAATTTTTAAAAAGGCAACCC -3'
Posted On2015-02-19