Incidental Mutation 'R3622:Dffb'
ID268663
Institutional Source Beutler Lab
Gene Symbol Dffb
Ensembl Gene ENSMUSG00000029027
Gene NameDNA fragmentation factor, beta subunit
Synonyms5730477D02Rik, caspase-activated DNase, Didff, CAD, CPAN, DFF40, 40kDa
MMRRC Submission 040677-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3622 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location153964449-153975126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 153965519 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 296 (T296A)
Ref Sequence ENSEMBL: ENSMUSP00000030893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030893] [ENSMUST00000058393] [ENSMUST00000105645] [ENSMUST00000133607] [ENSMUST00000141493] [ENSMUST00000147826]
PDB Structure
NMR STRUCTURE OF THE CAD DOMAIN OF CASPASE-ACTIVATED DNASE [SOLUTION NMR]
NMR STRUCTURE OF THE HETERODIMERIC COMPLEX BETWEEN CAD DOMAINS OF CAD AND ICAD [SOLUTION NMR]
CRYSTAL STRUCTURE OF CASPASE-ACTIVATED DNASE (CAD) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000030893
AA Change: T296A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030893
Gene: ENSMUSG00000029027
AA Change: T296A

DomainStartEndE-ValueType
CAD 9 81 2.48e-41 SMART
Pfam:DFF40 103 324 9.4e-97 PFAM
low complexity region 330 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058393
SMART Domains Protein: ENSMUSP00000054638
Gene: ENSMUSG00000047613

DomainStartEndE-ValueType
Pfam:UPF0688 6 228 9.9e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133524
Predicted Effect probably benign
Transcript: ENSMUST00000133607
Predicted Effect probably benign
Transcript: ENSMUST00000141493
Predicted Effect probably benign
Transcript: ENSMUST00000147826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219093
Meta Mutation Damage Score 0.408 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoptosis is a cell death process that removes toxic and/or useless cells during mammalian development. The apoptotic process is accompanied by shrinkage and fragmentation of the cells and nuclei and degradation of the chromosomal DNA into nucleosomal units. DNA fragmentation factor (DFF) is a heterodimeric protein of 40-kD (DFFB) and 45-kD (DFFA) subunits. DFFA is the substrate for caspase-3 and triggers DNA fragmentation during apoptosis. DFF becomes activated when DFFA is cleaved by caspase-3. The cleaved fragments of DFFA dissociate from DFFB, the active component of DFF. DFFB has been found to trigger both DNA fragmentation and chromatin condensation during apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene but the biological validity of some of these variants has not been determined. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and developmentally normal; however, mutant thymocytes and other cell types fail to undergo apoptotic DNA fragmentation in response to dexamethasone or other apoptotic stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,350,813 Y503* probably null Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Dpf1 G A 7: 29,316,206 probably null Het
Grid2ip T C 5: 143,386,019 S666P probably damaging Het
Gucy2e T A 11: 69,225,051 E835V probably damaging Het
Hdac5 G A 11: 102,195,818 P120S probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap A T 4: 56,759,925 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Muc5b T C 7: 141,851,858 probably benign Het
Olfr1461 T A 19: 13,165,656 M214K probably benign Het
Olfr390 A G 11: 73,787,741 T268A probably benign Het
Olfr912 A G 9: 38,581,496 Y73C probably damaging Het
Olfr994 C T 2: 85,430,493 C112Y probably benign Het
Oma1 T C 4: 103,366,091 I491T probably benign Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Plin4 G T 17: 56,104,112 T973K possibly damaging Het
R3hdm4 C T 10: 79,912,681 R143H possibly damaging Het
Rps18 G C 17: 33,952,273 probably null Het
Samd9l A T 6: 3,374,032 C1076* probably null Het
Scml4 T C 10: 42,930,611 probably benign Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Slc6a5 T C 7: 49,917,623 V275A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Srsf9 C T 5: 115,330,512 A69V probably damaging Het
Stfa2 A G 16: 36,404,071 Y90H probably damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Tnrc6c C T 11: 117,749,625 R1414C probably damaging Het
Tyk2 A T 9: 21,127,310 C8S probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Utp20 A G 10: 88,757,993 probably benign Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r116 A G 17: 23,386,051 S113G probably benign Het
Vps53 A C 11: 76,117,783 V237G probably benign Het
Other mutations in Dffb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02502:Dffb APN 4 153965616 unclassified probably benign
R0243:Dffb UTSW 4 153965378 nonsense probably null
R0244:Dffb UTSW 4 153974615 missense probably benign 0.33
R2483:Dffb UTSW 4 153965519 missense probably damaging 1.00
R3623:Dffb UTSW 4 153965519 missense probably damaging 1.00
R3624:Dffb UTSW 4 153965519 missense probably damaging 1.00
R4562:Dffb UTSW 4 153965456 missense probably damaging 1.00
R4912:Dffb UTSW 4 153965407 unclassified probably benign
R5015:Dffb UTSW 4 153972959 missense possibly damaging 0.84
R5986:Dffb UTSW 4 153965593 missense probably damaging 1.00
R6950:Dffb UTSW 4 153970092 missense probably benign
R7395:Dffb UTSW 4 153969113 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGTGGCCAAGTTCAGC -3'
(R):5'- TGGTAGACACTGCATCCACAG -3'

Sequencing Primer
(F):5'- ATGAGCACCGGCACTGAC -3'
(R):5'- TGCATCCACAGACAGCGAGTG -3'
Posted On2015-02-19