Incidental Mutation 'R3622:Hyal4'
ID268669
Institutional Source Beutler Lab
Gene Symbol Hyal4
Ensembl Gene ENSMUSG00000029680
Gene Namehyaluronoglucosaminidase 4
Synonyms
MMRRC Submission 040677-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3622 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location24748329-24767662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24765738 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 364 (S364C)
Ref Sequence ENSEMBL: ENSMUSP00000031691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031691]
Predicted Effect probably damaging
Transcript: ENSMUST00000031691
AA Change: S364C

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031691
Gene: ENSMUSG00000029680
AA Change: S364C

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Pfam:Glyco_hydro_56 41 373 3e-137 PFAM
EGF 375 447 2.81e0 SMART
low complexity region 453 473 N/A INTRINSIC
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is similar in structure to hyaluronidases. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. However, this protein has not yet been shown to have hyaluronidase activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,350,813 Y503* probably null Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dpf1 G A 7: 29,316,206 probably null Het
Grid2ip T C 5: 143,386,019 S666P probably damaging Het
Gucy2e T A 11: 69,225,051 E835V probably damaging Het
Hdac5 G A 11: 102,195,818 P120S probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap A T 4: 56,759,925 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Muc5b T C 7: 141,851,858 probably benign Het
Olfr1461 T A 19: 13,165,656 M214K probably benign Het
Olfr390 A G 11: 73,787,741 T268A probably benign Het
Olfr912 A G 9: 38,581,496 Y73C probably damaging Het
Olfr994 C T 2: 85,430,493 C112Y probably benign Het
Oma1 T C 4: 103,366,091 I491T probably benign Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Plin4 G T 17: 56,104,112 T973K possibly damaging Het
R3hdm4 C T 10: 79,912,681 R143H possibly damaging Het
Rps18 G C 17: 33,952,273 probably null Het
Samd9l A T 6: 3,374,032 C1076* probably null Het
Scml4 T C 10: 42,930,611 probably benign Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Slc6a5 T C 7: 49,917,623 V275A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Srsf9 C T 5: 115,330,512 A69V probably damaging Het
Stfa2 A G 16: 36,404,071 Y90H probably damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Tnrc6c C T 11: 117,749,625 R1414C probably damaging Het
Tyk2 A T 9: 21,127,310 C8S probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Utp20 A G 10: 88,757,993 probably benign Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r116 A G 17: 23,386,051 S113G probably benign Het
Vps53 A C 11: 76,117,783 V237G probably benign Het
Other mutations in Hyal4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Hyal4 APN 6 24755872 missense probably benign 0.03
IGL01791:Hyal4 APN 6 24763895 splice site probably benign
IGL02434:Hyal4 APN 6 24763858 nonsense probably null
IGL02523:Hyal4 APN 6 24765969 missense probably damaging 0.96
IGL03114:Hyal4 APN 6 24755965 missense probably benign 0.00
IGL02835:Hyal4 UTSW 6 24765715 missense probably benign 0.00
PIT4494001:Hyal4 UTSW 6 24755834 missense probably benign 0.05
R0196:Hyal4 UTSW 6 24756221 missense probably damaging 1.00
R0323:Hyal4 UTSW 6 24756194 missense probably benign 0.30
R0398:Hyal4 UTSW 6 24756671 missense probably damaging 0.97
R0946:Hyal4 UTSW 6 24755913 nonsense probably null
R0961:Hyal4 UTSW 6 24755746 utr 5 prime probably benign
R1906:Hyal4 UTSW 6 24756111 missense probably damaging 1.00
R1998:Hyal4 UTSW 6 24756311 missense probably benign 0.00
R2085:Hyal4 UTSW 6 24755750 start gained probably benign
R2483:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3623:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3624:Hyal4 UTSW 6 24765738 missense probably damaging 0.96
R3712:Hyal4 UTSW 6 24756514 missense probably damaging 1.00
R4031:Hyal4 UTSW 6 24756224 missense probably damaging 1.00
R5762:Hyal4 UTSW 6 24765862 missense possibly damaging 0.93
R6177:Hyal4 UTSW 6 24766090 nonsense probably null
R6442:Hyal4 UTSW 6 24765850 missense probably benign 0.08
R6494:Hyal4 UTSW 6 24765746 missense possibly damaging 0.79
R6901:Hyal4 UTSW 6 24756191 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTTCCGATCTGAGACCTTTGTG -3'
(R):5'- TTCTCTGCCATCACAGCTAGG -3'

Sequencing Primer
(F):5'- CCGATCTGAGACCTTTGTGTTACAG -3'
(R):5'- CATCACAGCTAGGTCAGTGTCTG -3'
Posted On2015-02-19