Incidental Mutation 'R3622:Tyk2'
ID268675
Institutional Source Beutler Lab
Gene Symbol Tyk2
Ensembl Gene ENSMUSG00000032175
Gene Nametyrosine kinase 2
SynonymsJTK1
MMRRC Submission 040677-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3622 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21104068-21131243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21127310 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 8 (C8S)
Ref Sequence ENSEMBL: ENSMUSP00000150214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001036] [ENSMUST00000214454] [ENSMUST00000214864] [ENSMUST00000216874]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001036
AA Change: C8S

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000001036
Gene: ENSMUSG00000032175
AA Change: C8S

DomainStartEndE-ValueType
B41 29 301 1.51e-26 SMART
Blast:B41 408 460 3e-12 BLAST
SH2 470 562 1.26e-2 SMART
STYKc 612 886 8.89e-15 SMART
TyrKc 917 1189 6.48e-114 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213717
Predicted Effect probably damaging
Transcript: ENSMUST00000214454
AA Change: C8S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214615
Predicted Effect probably damaging
Transcript: ENSMUST00000214864
AA Change: C8S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216874
AA Change: C8S

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.0292 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine kinase and, more specifically, the Janus kinases (JAKs) protein families. This protein associates with the cytoplasmic domain of type I and type II cytokine receptors and promulgate cytokine signals by phosphorylating receptor subunits. It is also component of both the type I and type III interferon signaling pathways. As such, it may play a role in anti-viral immunity. A mutation in this gene has been associated with hyperimmunoglobulin E syndrome (HIES) - a primary immunodeficiency characterized by elevated serum immunoglobulin E. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile, but differ from wild-type with respect to interleukin 12 mediated T cell function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,350,813 Y503* probably null Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dpf1 G A 7: 29,316,206 probably null Het
Grid2ip T C 5: 143,386,019 S666P probably damaging Het
Gucy2e T A 11: 69,225,051 E835V probably damaging Het
Hdac5 G A 11: 102,195,818 P120S probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap A T 4: 56,759,925 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Muc5b T C 7: 141,851,858 probably benign Het
Olfr1461 T A 19: 13,165,656 M214K probably benign Het
Olfr390 A G 11: 73,787,741 T268A probably benign Het
Olfr912 A G 9: 38,581,496 Y73C probably damaging Het
Olfr994 C T 2: 85,430,493 C112Y probably benign Het
Oma1 T C 4: 103,366,091 I491T probably benign Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Plin4 G T 17: 56,104,112 T973K possibly damaging Het
R3hdm4 C T 10: 79,912,681 R143H possibly damaging Het
Rps18 G C 17: 33,952,273 probably null Het
Samd9l A T 6: 3,374,032 C1076* probably null Het
Scml4 T C 10: 42,930,611 probably benign Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Slc6a5 T C 7: 49,917,623 V275A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Srsf9 C T 5: 115,330,512 A69V probably damaging Het
Stfa2 A G 16: 36,404,071 Y90H probably damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Tnrc6c C T 11: 117,749,625 R1414C probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Utp20 A G 10: 88,757,993 probably benign Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r116 A G 17: 23,386,051 S113G probably benign Het
Vps53 A C 11: 76,117,783 V237G probably benign Het
Other mutations in Tyk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Tyk2 APN 9 21120588 missense probably benign 0.27
IGL01015:Tyk2 APN 9 21120700 missense probably benign 0.00
IGL01096:Tyk2 APN 9 21108863 missense probably damaging 1.00
IGL01410:Tyk2 APN 9 21109364 missense probably damaging 1.00
IGL01613:Tyk2 APN 9 21120576 missense probably damaging 0.99
IGL01997:Tyk2 APN 9 21110494 missense probably damaging 1.00
IGL02249:Tyk2 APN 9 21120407 missense probably damaging 1.00
IGL02407:Tyk2 APN 9 21109227 splice site probably benign
IGL02538:Tyk2 APN 9 21111043 missense possibly damaging 0.94
IGL03185:Tyk2 APN 9 21109384 missense probably damaging 1.00
ANU74:Tyk2 UTSW 9 21116158 missense probably damaging 1.00
R0355:Tyk2 UTSW 9 21114190 splice site probably null
R0667:Tyk2 UTSW 9 21108871 missense probably damaging 1.00
R0862:Tyk2 UTSW 9 21116167 missense probably benign 0.00
R0883:Tyk2 UTSW 9 21111137 missense possibly damaging 0.61
R1554:Tyk2 UTSW 9 21107922 missense probably damaging 0.96
R1575:Tyk2 UTSW 9 21115462 missense probably benign 0.00
R1664:Tyk2 UTSW 9 21120353 missense probably damaging 1.00
R1676:Tyk2 UTSW 9 21115249 nonsense probably null
R1843:Tyk2 UTSW 9 21121554 nonsense probably null
R1871:Tyk2 UTSW 9 21121441 missense probably damaging 1.00
R2044:Tyk2 UTSW 9 21120341 missense probably damaging 1.00
R2137:Tyk2 UTSW 9 21110985 intron probably benign
R2197:Tyk2 UTSW 9 21115207 missense probably damaging 1.00
R2883:Tyk2 UTSW 9 21110587 missense probably benign 0.01
R2941:Tyk2 UTSW 9 21111119 missense probably benign 0.00
R3001:Tyk2 UTSW 9 21109321 missense probably benign 0.00
R3002:Tyk2 UTSW 9 21109321 missense probably benign 0.00
R3196:Tyk2 UTSW 9 21124032 missense possibly damaging 0.80
R4024:Tyk2 UTSW 9 21115919 missense probably damaging 1.00
R4459:Tyk2 UTSW 9 21124415 missense probably damaging 1.00
R4604:Tyk2 UTSW 9 21108009 missense probably damaging 1.00
R4664:Tyk2 UTSW 9 21114207 missense probably damaging 0.99
R4666:Tyk2 UTSW 9 21114207 missense probably damaging 0.99
R4915:Tyk2 UTSW 9 21111137 missense probably benign 0.41
R4971:Tyk2 UTSW 9 21120501 critical splice donor site probably null
R5014:Tyk2 UTSW 9 21115830 splice site probably null
R5191:Tyk2 UTSW 9 21107497 missense probably damaging 0.98
R5305:Tyk2 UTSW 9 21109381 missense probably damaging 0.99
R5356:Tyk2 UTSW 9 21115744 missense probably benign 0.03
R5501:Tyk2 UTSW 9 21121612 missense probably damaging 1.00
R6025:Tyk2 UTSW 9 21115960 missense probably benign 0.05
R6113:Tyk2 UTSW 9 21107922 missense probably damaging 1.00
R6159:Tyk2 UTSW 9 21110504 missense probably damaging 0.99
R6608:Tyk2 UTSW 9 21108016 missense probably benign 0.02
R6610:Tyk2 UTSW 9 21108016 missense probably benign 0.02
R6612:Tyk2 UTSW 9 21108016 missense probably benign 0.02
R6870:Tyk2 UTSW 9 21124954 missense probably damaging 1.00
R7216:Tyk2 UTSW 9 21120526 missense probably benign 0.01
R7218:Tyk2 UTSW 9 21105054 missense probably damaging 1.00
R7298:Tyk2 UTSW 9 21108860 missense probably benign 0.35
R7322:Tyk2 UTSW 9 21110204 missense probably benign
R7347:Tyk2 UTSW 9 21108034 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACCGACTTTGTGTGCGATG -3'
(R):5'- TTTTCACATGTGCACGCAC -3'

Sequencing Primer
(F):5'- ATGTGGATGCAGACCTCCTC -3'
(R):5'- TCTGGTGCATCTGAAGACAGCTAC -3'
Posted On2015-02-19