Incidental Mutation 'R3622:Stfa2'
ID268687
Institutional Source Beutler Lab
Gene Symbol Stfa2
Ensembl Gene ENSMUSG00000022902
Gene Namestefin A2
SynonymsStf2
MMRRC Submission 040677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3622 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location36403992-36408457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36404071 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 90 (Y90H)
Ref Sequence ENSEMBL: ENSMUSP00000023619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023619]
Predicted Effect probably damaging
Transcript: ENSMUST00000023619
AA Change: Y90H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023619
Gene: ENSMUSG00000022902
AA Change: Y90H

DomainStartEndE-ValueType
CY 7 103 2.32e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157864
Meta Mutation Damage Score 0.0368 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T A 7: 120,350,813 Y503* probably null Het
Akap9 C A 5: 3,976,235 Q1297K possibly damaging Het
Dffb T C 4: 153,965,519 T296A probably damaging Het
Dpf1 G A 7: 29,316,206 probably null Het
Grid2ip T C 5: 143,386,019 S666P probably damaging Het
Gucy2e T A 11: 69,225,051 E835V probably damaging Het
Hdac5 G A 11: 102,195,818 P120S probably benign Het
Htr1d T C 4: 136,443,504 I348T probably damaging Het
Hyal4 A T 6: 24,765,738 S364C probably damaging Het
Igkv1-133 A T 6: 67,724,960 Q16L probably benign Het
Ikbkap A T 4: 56,759,925 probably null Het
Itga10 C T 3: 96,651,738 probably benign Het
Met A T 6: 17,549,086 D979V probably damaging Het
Mga A G 2: 119,941,764 T1702A probably damaging Het
Midn A G 10: 80,150,310 D78G probably benign Het
Muc5b T C 7: 141,851,858 probably benign Het
Olfr1461 T A 19: 13,165,656 M214K probably benign Het
Olfr390 A G 11: 73,787,741 T268A probably benign Het
Olfr912 A G 9: 38,581,496 Y73C probably damaging Het
Olfr994 C T 2: 85,430,493 C112Y probably benign Het
Oma1 T C 4: 103,366,091 I491T probably benign Het
Pbld2 T C 10: 63,061,691 L57P probably damaging Het
Phka2 T A X: 160,544,295 Y334* probably null Het
Plin4 G T 17: 56,104,112 T973K possibly damaging Het
R3hdm4 C T 10: 79,912,681 R143H possibly damaging Het
Rps18 G C 17: 33,952,273 probably null Het
Samd9l A T 6: 3,374,032 C1076* probably null Het
Scml4 T C 10: 42,930,611 probably benign Het
Slc16a10 A G 10: 40,141,894 V48A probably benign Het
Slc6a5 T C 7: 49,917,623 V275A probably benign Het
Smad9 C T 3: 54,789,284 R257W probably damaging Het
Snrpb C A 2: 130,175,379 R73L probably null Het
Srsf9 C T 5: 115,330,512 A69V probably damaging Het
Tgm6 T A 2: 130,151,761 V640E possibly damaging Het
Tnrc6c C T 11: 117,749,625 R1414C probably damaging Het
Tyk2 A T 9: 21,127,310 C8S probably damaging Het
Upp2 G A 2: 58,790,116 R300Q possibly damaging Het
Utp20 A G 10: 88,757,993 probably benign Het
Veph1 C T 3: 66,215,437 V224I probably benign Het
Vmn1r30 A T 6: 58,435,452 F132I probably benign Het
Vmn2r116 A G 17: 23,386,051 S113G probably benign Het
Vps53 A C 11: 76,117,783 V237G probably benign Het
Other mutations in Stfa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02484:Stfa2 APN 16 36405207 missense probably damaging 0.98
R1510:Stfa2 UTSW 16 36408311 missense possibly damaging 0.87
R1829:Stfa2 UTSW 16 36405202 missense probably damaging 0.99
R1829:Stfa2 UTSW 16 36405211 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGTCTAGGAGTAAGCATCAACAC -3'
(R):5'- CAATGGAGATCCTCGAGAATAAAC -3'

Sequencing Primer
(F):5'- GGAGTAAGCATCAACACAATTCTG -3'
(R):5'- TCCTCGAGAATAAACTAACATCCTTC -3'
Posted On2015-02-19